Incidental Mutation 'R4969:Egfem1'
ID384250
Institutional Source Beutler Lab
Gene Symbol Egfem1
Ensembl Gene ENSMUSG00000063600
Gene NameEGF-like and EMI domain containing 1
Synonyms6130401L20Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R4969 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location29082023-29691209 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 29582996 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 194 (Y194N)
Ref Sequence ENSEMBL: ENSMUSP00000112943 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118531] [ENSMUST00000119598] [ENSMUST00000146943]
Predicted Effect probably benign
Transcript: ENSMUST00000118531
AA Change: Y218N

PolyPhen 2 Score 0.314 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000112907
Gene: ENSMUSG00000063600
AA Change: Y218N

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:EMI 30 104 1.4e-15 PFAM
Blast:EGF_like 108 145 7e-10 BLAST
EGF 150 187 2.16e1 SMART
EGF_CA 188 228 2.66e-10 SMART
EGF 237 274 1.08e-1 SMART
EGF_like 275 313 9.19e-5 SMART
low complexity region 317 331 N/A INTRINSIC
low complexity region 357 371 N/A INTRINSIC
EGF 391 424 1.09e1 SMART
Blast:EGF_like 449 481 5e-10 BLAST
EGF 492 526 2.43e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000119598
AA Change: Y194N

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112943
Gene: ENSMUSG00000063600
AA Change: Y194N

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:EMI 31 102 1.1e-15 PFAM
Blast:EGF_like 108 145 6e-10 BLAST
EGF_CA 164 204 1.61e-9 SMART
EGF 208 244 6.4e-4 SMART
EGF_CA 245 285 1.81e-12 SMART
EGF 294 331 1.08e-1 SMART
EGF_like 332 370 9.19e-5 SMART
low complexity region 374 388 N/A INTRINSIC
low complexity region 414 428 N/A INTRINSIC
EGF 448 481 1.09e1 SMART
Blast:EGF_like 506 538 5e-10 BLAST
EGF 549 583 2.43e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126420
Predicted Effect unknown
Transcript: ENSMUST00000140288
AA Change: Y65N
SMART Domains Protein: ENSMUSP00000117016
Gene: ENSMUSG00000063600
AA Change: Y65N

DomainStartEndE-ValueType
EGF_like 5 35 4.32e-1 SMART
EGF_CA 36 76 2.66e-10 SMART
EGF 85 122 1.08e-1 SMART
low complexity region 124 138 N/A INTRINSIC
low complexity region 164 178 N/A INTRINSIC
EGF 198 231 1.09e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143483
SMART Domains Protein: ENSMUSP00000114146
Gene: ENSMUSG00000063600

DomainStartEndE-ValueType
EGF 22 59 2.16e1 SMART
EGF_CA 60 100 2.66e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146943
SMART Domains Protein: ENSMUSP00000118156
Gene: ENSMUSG00000063600

DomainStartEndE-ValueType
Pfam:EMI 17 91 1.8e-16 PFAM
Blast:EGF_like 95 132 2e-11 BLAST
EGF 137 174 2.16e1 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 A G 7: 46,105,519 I1525T probably benign Het
Agtpbp1 A G 13: 59,500,578 V476A probably benign Het
Aipl1 A G 11: 72,031,430 I151T probably benign Het
Apc C T 18: 34,312,918 R938* probably null Het
Atp2a2 A G 5: 122,458,491 F855S possibly damaging Het
Axdnd1 T C 1: 156,395,505 T261A possibly damaging Het
Cbfa2t2 A G 2: 154,523,980 D370G probably damaging Het
Cep350 T C 1: 155,860,279 I2964V probably damaging Het
Clec16a T C 16: 10,568,511 V158A probably damaging Het
Col6a5 G A 9: 105,864,607 T2371I probably damaging Het
Cpne8 T C 15: 90,619,726 T79A probably damaging Het
Cyp2b13 A G 7: 26,080,988 R145G probably damaging Het
Disc1 G A 8: 125,124,550 W391* probably null Het
Dnah8 G A 17: 30,723,014 V1745I probably damaging Het
Dsp T C 13: 38,192,910 V1557A probably benign Het
Eif4a3 A G 11: 119,288,879 Y361H probably damaging Het
Esd T A 14: 74,744,713 S189R possibly damaging Het
Fancf A T 7: 51,861,448 Y269* probably null Het
Fbln2 A T 6: 91,271,587 H1078L possibly damaging Het
Fbxw13 A G 9: 109,181,524 probably null Het
Fcgr2b A T 1: 170,963,372 V284D probably benign Het
Fuz G A 7: 44,900,294 G363R probably damaging Het
Gas7 A G 11: 67,683,408 E403G probably damaging Het
Gnl1 A G 17: 35,980,689 D49G possibly damaging Het
Gucy2g A G 19: 55,226,013 V561A probably benign Het
H1fnt A T 15: 98,256,335 V311E unknown Het
Hebp2 T C 10: 18,544,374 T104A probably benign Het
Ighv1-19 T A 12: 114,708,757 Q80L probably benign Het
Kctd19 T A 8: 105,396,327 probably null Het
Kdm3b T C 18: 34,822,375 L905P probably damaging Het
Klkb1 T C 8: 45,282,777 D183G probably benign Het
Krt6b T C 15: 101,680,025 R67G possibly damaging Het
Krt75 T C 15: 101,573,813 I7V probably benign Het
Lpo A T 11: 87,806,925 N685K probably benign Het
Mroh7 A T 4: 106,680,873 I1202N probably benign Het
Muc4 T A 16: 32,754,572 M1482K probably benign Het
Mylk T A 16: 34,971,440 V1494E probably damaging Het
Neurl4 A G 11: 69,911,087 D17G probably damaging Het
Nkx6-3 A G 8: 23,157,709 Y228C probably damaging Het
Nprl2 G A 9: 107,543,074 probably null Het
Nxf1 A G 19: 8,762,305 probably null Het
Olfr1238 A G 2: 89,406,426 F218L probably benign Het
Olfr654 A T 7: 104,588,523 N240Y probably damaging Het
Pde3b A G 7: 114,519,612 E662G possibly damaging Het
Plekhm3 G A 1: 64,937,919 R131C probably damaging Het
Plpp7 T C 2: 32,095,938 S43P probably benign Het
Pramel5 A G 4: 144,271,617 L352P probably damaging Het
Prepl T C 17: 85,088,474 S27G probably benign Het
Ptprd A G 4: 76,133,305 I227T probably damaging Het
Pttg1ip C T 10: 77,584,020 Q6* probably null Het
Rgl1 C T 1: 152,549,062 probably null Het
Riiad1 C A 3: 94,472,866 G41* probably null Het
Rnf214 C T 9: 45,896,188 R239H probably damaging Het
Rpap3 C T 15: 97,686,526 V346I probably benign Het
Scaf4 G A 16: 90,251,943 Q328* probably null Het
Sec23a A G 12: 59,004,488 probably null Het
Slc5a8 T A 10: 88,904,912 probably null Het
Slc9a8 A G 2: 167,446,529 T183A probably benign Het
Sod3 A T 5: 52,368,394 H145L probably damaging Het
Sp4 A G 12: 118,299,606 V235A probably damaging Het
Spp1 A C 5: 104,440,287 E185A possibly damaging Het
Susd1 A T 4: 59,351,679 W461R probably benign Het
Svil A C 18: 5,095,516 K1124Q probably damaging Het
Tdrd12 A T 7: 35,487,295 probably null Het
Terb1 A T 8: 104,495,163 N168K probably benign Het
Tnnt1 A G 7: 4,507,574 L216P probably damaging Het
Ttc28 A G 5: 111,276,255 K1463E probably damaging Het
Twf2 T G 9: 106,211,899 probably null Het
Urb1 C T 16: 90,805,411 R90Q probably damaging Het
Wdr45b A T 11: 121,328,824 C299* probably null Het
Wrap73 A G 4: 154,152,681 S54G probably damaging Het
Zeb2 T C 2: 44,998,919 K323R probably damaging Het
Zfp410 T C 12: 84,331,808 I302T possibly damaging Het
Other mutations in Egfem1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00766:Egfem1 APN 3 29657153 missense possibly damaging 0.54
IGL02111:Egfem1 APN 3 29650896 splice site probably null
IGL02325:Egfem1 APN 3 29151917 missense probably benign 0.01
IGL02450:Egfem1 APN 3 29657268 critical splice donor site probably null
IGL02543:Egfem1 APN 3 29668380 missense probably benign 0.01
IGL02835:Egfem1 UTSW 3 29657241 missense probably damaging 1.00
P0033:Egfem1 UTSW 3 29690191 missense probably damaging 1.00
R0010:Egfem1 UTSW 3 29582919 missense probably damaging 1.00
R0294:Egfem1 UTSW 3 29690121 missense probably damaging 1.00
R0379:Egfem1 UTSW 3 29668250 missense possibly damaging 0.92
R1479:Egfem1 UTSW 3 29657165 missense probably damaging 1.00
R1572:Egfem1 UTSW 3 29648271 missense probably benign 0.02
R1754:Egfem1 UTSW 3 29668333 missense possibly damaging 0.68
R2568:Egfem1 UTSW 3 29582931 missense probably damaging 1.00
R2679:Egfem1 UTSW 3 29670676 missense probably benign 0.01
R3411:Egfem1 UTSW 3 29583021 missense probably damaging 1.00
R3801:Egfem1 UTSW 3 29151926 missense probably benign 0.14
R4049:Egfem1 UTSW 3 29686731 missense probably benign 0.01
R4851:Egfem1 UTSW 3 29151883 missense possibly damaging 0.92
R4917:Egfem1 UTSW 3 29151893 missense probably damaging 1.00
R4918:Egfem1 UTSW 3 29151893 missense probably damaging 1.00
R4997:Egfem1 UTSW 3 29153590 missense probably benign 0.00
R5148:Egfem1 UTSW 3 29457823 intron probably benign
R5194:Egfem1 UTSW 3 29357196 critical splice donor site probably null
R5284:Egfem1 UTSW 3 29650787 missense possibly damaging 0.53
R5354:Egfem1 UTSW 3 29082212 critical splice donor site probably null
R5627:Egfem1 UTSW 3 29668399 nonsense probably null
R5677:Egfem1 UTSW 3 29690174 missense probably damaging 0.99
R5928:Egfem1 UTSW 3 29582928 missense possibly damaging 0.92
R5982:Egfem1 UTSW 3 29657270 splice site probably null
R6419:Egfem1 UTSW 3 29657249 missense probably damaging 1.00
R6475:Egfem1 UTSW 3 29657163 missense probably damaging 1.00
R6586:Egfem1 UTSW 3 29662411 nonsense probably null
X0028:Egfem1 UTSW 3 29657146 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGGTTGCTGTTCAAACCAC -3'
(R):5'- GGAATTGAACTCAAATACCATCAGC -3'

Sequencing Primer
(F):5'- CTTGTTTACATAGTGGAGCAAAACG -3'
(R):5'- ATGGCTTCAAGCTGGCT -3'
Posted On2016-04-27