Incidental Mutation 'R4969:Spp1'
ID384260
Institutional Source Beutler Lab
Gene Symbol Spp1
Ensembl Gene ENSMUSG00000029304
Gene Namesecreted phosphoprotein 1
SynonymsOpn, ETA-1, OP, Spp-1, osteopontin-like protein, bone sialoprotein 1, 44kDa bone phosphoprotein, osteopontin, Apl-1, Opnl, BNSP, Ric, 2ar, minopontin
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4969 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location104435118-104441050 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 104440287 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Alanine at position 185 (E185A)
Ref Sequence ENSEMBL: ENSMUSP00000108368 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031243] [ENSMUST00000086833] [ENSMUST00000112746] [ENSMUST00000112747] [ENSMUST00000112748] [ENSMUST00000132457] [ENSMUST00000145084]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031243
AA Change: E185A

PolyPhen 2 Score 0.675 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000031243
Gene: ENSMUSG00000029304
AA Change: E185A

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
OSTEO 17 294 2.5e-157 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000086833
AA Change: E186A

PolyPhen 2 Score 0.226 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000084043
Gene: ENSMUSG00000029304
AA Change: E186A

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
OSTEO 17 295 2.21e-158 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112746
SMART Domains Protein: ENSMUSP00000108366
Gene: ENSMUSG00000029304

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Osteopontin 20 164 2.2e-67 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000112747
AA Change: E185A

PolyPhen 2 Score 0.675 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000108367
Gene: ENSMUSG00000029304
AA Change: E185A

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
OSTEO 17 294 2.5e-157 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000112748
AA Change: E185A

PolyPhen 2 Score 0.675 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000108368
Gene: ENSMUSG00000029304
AA Change: E185A

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
OSTEO 17 294 2.5e-157 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132457
Predicted Effect probably benign
Transcript: ENSMUST00000145084
SMART Domains Protein: ENSMUSP00000117338
Gene: ENSMUSG00000029304

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Osteopontin 20 152 1.2e-60 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199139
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in the attachment of osteoclasts to the mineralized bone matrix. The encoded protein is secreted and binds hydroxyapatite with high affinity. The osteoclast vitronectin receptor is found in the cell membrane and may be involved in the binding to this protein. This protein is also a cytokine that upregulates expression of interferon-gamma and interleukin-12. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Two alleles determine natural resistance/susceptibility to the lethal effects of the Gilliam strain of Rickettsia tsutsugamushi. Mice homozygous for a knock-out allele exhibit abnormal osteoclast physiology, macrophage recruitment, wound healing, response to injury, and inflammatory response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 A G 7: 46,105,519 I1525T probably benign Het
Agtpbp1 A G 13: 59,500,578 V476A probably benign Het
Aipl1 A G 11: 72,031,430 I151T probably benign Het
Apc C T 18: 34,312,918 R938* probably null Het
Atp2a2 A G 5: 122,458,491 F855S possibly damaging Het
Axdnd1 T C 1: 156,395,505 T261A possibly damaging Het
Cbfa2t2 A G 2: 154,523,980 D370G probably damaging Het
Cep350 T C 1: 155,860,279 I2964V probably damaging Het
Clec16a T C 16: 10,568,511 V158A probably damaging Het
Col6a5 G A 9: 105,864,607 T2371I probably damaging Het
Cpne8 T C 15: 90,619,726 T79A probably damaging Het
Cyp2b13 A G 7: 26,080,988 R145G probably damaging Het
Disc1 G A 8: 125,124,550 W391* probably null Het
Dnah8 G A 17: 30,723,014 V1745I probably damaging Het
Dsp T C 13: 38,192,910 V1557A probably benign Het
Egfem1 T A 3: 29,582,996 Y194N probably damaging Het
Eif4a3 A G 11: 119,288,879 Y361H probably damaging Het
Esd T A 14: 74,744,713 S189R possibly damaging Het
Fancf A T 7: 51,861,448 Y269* probably null Het
Fbln2 A T 6: 91,271,587 H1078L possibly damaging Het
Fbxw13 A G 9: 109,181,524 probably null Het
Fcgr2b A T 1: 170,963,372 V284D probably benign Het
Fuz G A 7: 44,900,294 G363R probably damaging Het
Gas7 A G 11: 67,683,408 E403G probably damaging Het
Gnl1 A G 17: 35,980,689 D49G possibly damaging Het
Gucy2g A G 19: 55,226,013 V561A probably benign Het
H1fnt A T 15: 98,256,335 V311E unknown Het
Hebp2 T C 10: 18,544,374 T104A probably benign Het
Ighv1-19 T A 12: 114,708,757 Q80L probably benign Het
Kctd19 T A 8: 105,396,327 probably null Het
Kdm3b T C 18: 34,822,375 L905P probably damaging Het
Klkb1 T C 8: 45,282,777 D183G probably benign Het
Krt6b T C 15: 101,680,025 R67G possibly damaging Het
Krt75 T C 15: 101,573,813 I7V probably benign Het
Lpo A T 11: 87,806,925 N685K probably benign Het
Mroh7 A T 4: 106,680,873 I1202N probably benign Het
Muc4 T A 16: 32,754,572 M1482K probably benign Het
Mylk T A 16: 34,971,440 V1494E probably damaging Het
Neurl4 A G 11: 69,911,087 D17G probably damaging Het
Nkx6-3 A G 8: 23,157,709 Y228C probably damaging Het
Nprl2 G A 9: 107,543,074 probably null Het
Nxf1 A G 19: 8,762,305 probably null Het
Olfr1238 A G 2: 89,406,426 F218L probably benign Het
Olfr654 A T 7: 104,588,523 N240Y probably damaging Het
Pde3b A G 7: 114,519,612 E662G possibly damaging Het
Plekhm3 G A 1: 64,937,919 R131C probably damaging Het
Plpp7 T C 2: 32,095,938 S43P probably benign Het
Pramel5 A G 4: 144,271,617 L352P probably damaging Het
Prepl T C 17: 85,088,474 S27G probably benign Het
Ptprd A G 4: 76,133,305 I227T probably damaging Het
Pttg1ip C T 10: 77,584,020 Q6* probably null Het
Rgl1 C T 1: 152,549,062 probably null Het
Riiad1 C A 3: 94,472,866 G41* probably null Het
Rnf214 C T 9: 45,896,188 R239H probably damaging Het
Rpap3 C T 15: 97,686,526 V346I probably benign Het
Scaf4 G A 16: 90,251,943 Q328* probably null Het
Sec23a A G 12: 59,004,488 probably null Het
Slc5a8 T A 10: 88,904,912 probably null Het
Slc9a8 A G 2: 167,446,529 T183A probably benign Het
Sod3 A T 5: 52,368,394 H145L probably damaging Het
Sp4 A G 12: 118,299,606 V235A probably damaging Het
Susd1 A T 4: 59,351,679 W461R probably benign Het
Svil A C 18: 5,095,516 K1124Q probably damaging Het
Tdrd12 A T 7: 35,487,295 probably null Het
Terb1 A T 8: 104,495,163 N168K probably benign Het
Tnnt1 A G 7: 4,507,574 L216P probably damaging Het
Ttc28 A G 5: 111,276,255 K1463E probably damaging Het
Twf2 T G 9: 106,211,899 probably null Het
Urb1 C T 16: 90,805,411 R90Q probably damaging Het
Wdr45b A T 11: 121,328,824 C299* probably null Het
Wrap73 A G 4: 154,152,681 S54G probably damaging Het
Zeb2 T C 2: 44,998,919 K323R probably damaging Het
Zfp410 T C 12: 84,331,808 I302T possibly damaging Het
Other mutations in Spp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4755:Spp1 UTSW 5 104435215 intron probably benign
R5531:Spp1 UTSW 5 104440558 missense probably benign 0.12
R6198:Spp1 UTSW 5 104439508 unclassified probably null
R6291:Spp1 UTSW 5 104439376 missense possibly damaging 0.89
R6636:Spp1 UTSW 5 104440530 missense possibly damaging 0.51
X0011:Spp1 UTSW 5 104440422 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- ATGATTGATATGAAGCTGACTGGTG -3'
(R):5'- ACTATCGATCACATCCGACTGATC -3'

Sequencing Primer
(F):5'- GCTGACTGGTGAAATATAAAGTACAC -3'
(R):5'- GACTGATCGGCACTCTCCTG -3'
Posted On2016-04-27