Incidental Mutation 'R4969:H1fnt'
ID384304
Institutional Source Beutler Lab
Gene Symbol H1fnt
Ensembl Gene ENSMUSG00000048077
Gene NameH1 histone family, member N, testis-specific
Synonyms1700026P10Rik, H1T2
Accession Numbers

Genbank: NM_027304; MGI: 1917319

Is this an essential gene? Possibly non essential (E-score: 0.390) question?
Stock #R4969 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location98255986-98257293 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 98256335 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 311 (V311E)
Ref Sequence ENSEMBL: ENSMUSP00000127616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060855]
Predicted Effect unknown
Transcript: ENSMUST00000060855
AA Change: V311E
SMART Domains Protein: ENSMUSP00000127616
Gene: ENSMUSG00000048077
AA Change: V311E

DomainStartEndE-ValueType
low complexity region 134 245 N/A INTRINSIC
low complexity region 253 276 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Nucleosomes consist of approximately 146 bp of DNA wrapped around a histone octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. This gene is intronless and encodes a replication-independent histone that is a member of the histone H1 family. This gene encodes a testis specific protein that is required for spermatogenesis and male fertility. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous null male mice display reduced fertility with asthenozoospermia, oligozoospermia, and teratozoospermia. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, knock-out(2)

Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 A G 7: 46,105,519 I1525T probably benign Het
Agtpbp1 A G 13: 59,500,578 V476A probably benign Het
Aipl1 A G 11: 72,031,430 I151T probably benign Het
Apc C T 18: 34,312,918 R938* probably null Het
Atp2a2 A G 5: 122,458,491 F855S possibly damaging Het
Axdnd1 T C 1: 156,395,505 T261A possibly damaging Het
Cbfa2t2 A G 2: 154,523,980 D370G probably damaging Het
Cep350 T C 1: 155,860,279 I2964V probably damaging Het
Clec16a T C 16: 10,568,511 V158A probably damaging Het
Col6a5 G A 9: 105,864,607 T2371I probably damaging Het
Cpne8 T C 15: 90,619,726 T79A probably damaging Het
Cyp2b13 A G 7: 26,080,988 R145G probably damaging Het
Disc1 G A 8: 125,124,550 W391* probably null Het
Dnah8 G A 17: 30,723,014 V1745I probably damaging Het
Dsp T C 13: 38,192,910 V1557A probably benign Het
Egfem1 T A 3: 29,582,996 Y194N probably damaging Het
Eif4a3 A G 11: 119,288,879 Y361H probably damaging Het
Esd T A 14: 74,744,713 S189R possibly damaging Het
Fancf A T 7: 51,861,448 Y269* probably null Het
Fbln2 A T 6: 91,271,587 H1078L possibly damaging Het
Fbxw13 A G 9: 109,181,524 probably null Het
Fcgr2b A T 1: 170,963,372 V284D probably benign Het
Fuz G A 7: 44,900,294 G363R probably damaging Het
Gas7 A G 11: 67,683,408 E403G probably damaging Het
Gnl1 A G 17: 35,980,689 D49G possibly damaging Het
Gucy2g A G 19: 55,226,013 V561A probably benign Het
Hebp2 T C 10: 18,544,374 T104A probably benign Het
Ighv1-19 T A 12: 114,708,757 Q80L probably benign Het
Kctd19 T A 8: 105,396,327 probably null Het
Kdm3b T C 18: 34,822,375 L905P probably damaging Het
Klkb1 T C 8: 45,282,777 D183G probably benign Het
Krt6b T C 15: 101,680,025 R67G possibly damaging Het
Krt75 T C 15: 101,573,813 I7V probably benign Het
Lpo A T 11: 87,806,925 N685K probably benign Het
Mroh7 A T 4: 106,680,873 I1202N probably benign Het
Muc4 T A 16: 32,754,572 M1482K probably benign Het
Mylk T A 16: 34,971,440 V1494E probably damaging Het
Neurl4 A G 11: 69,911,087 D17G probably damaging Het
Nkx6-3 A G 8: 23,157,709 Y228C probably damaging Het
Nprl2 G A 9: 107,543,074 probably null Het
Nxf1 A G 19: 8,762,305 probably null Het
Olfr1238 A G 2: 89,406,426 F218L probably benign Het
Olfr654 A T 7: 104,588,523 N240Y probably damaging Het
Pde3b A G 7: 114,519,612 E662G possibly damaging Het
Plekhm3 G A 1: 64,937,919 R131C probably damaging Het
Plpp7 T C 2: 32,095,938 S43P probably benign Het
Pramel5 A G 4: 144,271,617 L352P probably damaging Het
Prepl T C 17: 85,088,474 S27G probably benign Het
Ptprd A G 4: 76,133,305 I227T probably damaging Het
Pttg1ip C T 10: 77,584,020 Q6* probably null Het
Rgl1 C T 1: 152,549,062 probably null Het
Riiad1 C A 3: 94,472,866 G41* probably null Het
Rnf214 C T 9: 45,896,188 R239H probably damaging Het
Rpap3 C T 15: 97,686,526 V346I probably benign Het
Scaf4 G A 16: 90,251,943 Q328* probably null Het
Sec23a A G 12: 59,004,488 probably null Het
Slc5a8 T A 10: 88,904,912 probably null Het
Slc9a8 A G 2: 167,446,529 T183A probably benign Het
Sod3 A T 5: 52,368,394 H145L probably damaging Het
Sp4 A G 12: 118,299,606 V235A probably damaging Het
Spp1 A C 5: 104,440,287 E185A possibly damaging Het
Susd1 A T 4: 59,351,679 W461R probably benign Het
Svil A C 18: 5,095,516 K1124Q probably damaging Het
Tdrd12 A T 7: 35,487,295 probably null Het
Terb1 A T 8: 104,495,163 N168K probably benign Het
Tnnt1 A G 7: 4,507,574 L216P probably damaging Het
Ttc28 A G 5: 111,276,255 K1463E probably damaging Het
Twf2 T G 9: 106,211,899 probably null Het
Urb1 C T 16: 90,805,411 R90Q probably damaging Het
Wdr45b A T 11: 121,328,824 C299* probably null Het
Wrap73 A G 4: 154,152,681 S54G probably damaging Het
Zeb2 T C 2: 44,998,919 K323R probably damaging Het
Zfp410 T C 12: 84,331,808 I302T possibly damaging Het
Other mutations in H1fnt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01693:H1fnt APN 15 98256381 missense unknown
IGL02088:H1fnt APN 15 98257178 missense probably damaging 0.98
IGL02322:H1fnt APN 15 98256876 missense possibly damaging 0.94
IGL02697:H1fnt APN 15 98257169 missense probably benign 0.02
F2404:H1fnt UTSW 15 98257209 missense possibly damaging 0.95
R0584:H1fnt UTSW 15 98257077 nonsense probably null
R1022:H1fnt UTSW 15 98256755 missense unknown
R1024:H1fnt UTSW 15 98256755 missense unknown
R1462:H1fnt UTSW 15 98256573 missense unknown
R1462:H1fnt UTSW 15 98256573 missense unknown
R1665:H1fnt UTSW 15 98256915 missense probably benign 0.00
R1733:H1fnt UTSW 15 98256135 missense unknown
R2213:H1fnt UTSW 15 98256338 missense unknown
R4683:H1fnt UTSW 15 98257040 missense probably damaging 0.99
R6241:H1fnt UTSW 15 98256771 missense unknown
R6489:H1fnt UTSW 15 98257007 nonsense probably null
R6703:H1fnt UTSW 15 98257272 start gained probably benign
Predicted Primers PCR Primer
(F):5'- AAGACTTTGTGCATGCTTTTCC -3'
(R):5'- ACCTAGTGCGTTCCAAAGCC -3'

Sequencing Primer
(F):5'- GAGCGTTGTCCAGAGCTG -3'
(R):5'- TTCCAAAGCCCGGGAACAGG -3'
Posted On2016-04-27