Incidental Mutation 'R4970:Zscan29'
ID384339
Institutional Source Beutler Lab
Gene Symbol Zscan29
Ensembl Gene ENSMUSG00000050619
Gene Namezinc finger SCAN domains 29
SynonymsZfp690
MMRRC Submission 042565-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R4970 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location121158273-121171125 bp(-) (GRCm38)
Type of Mutationsplice site (4 bp from exon)
DNA Base Change (assembly) T to C at 121169195 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125987 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039541] [ENSMUST00000079024] [ENSMUST00000110657] [ENSMUST00000110658] [ENSMUST00000110661] [ENSMUST00000146243] [ENSMUST00000163766] [ENSMUST00000186659]
Predicted Effect probably benign
Transcript: ENSMUST00000039541
SMART Domains Protein: ENSMUSP00000044049
Gene: ENSMUSG00000027263

DomainStartEndE-ValueType
Pfam:Spc97_Spc98 4 573 2.8e-111 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000079024
SMART Domains Protein: ENSMUSP00000078033
Gene: ENSMUSG00000050619

DomainStartEndE-ValueType
SCAN 13 125 5.83e-70 SMART
Pfam:Myb_DNA-bind_4 238 323 3e-21 PFAM
Pfam:Myb_DNA-bind_4 399 484 4.1e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110657
SMART Domains Protein: ENSMUSP00000106285
Gene: ENSMUSG00000027263

DomainStartEndE-ValueType
Pfam:Spc97_Spc98 4 572 3.1e-115 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110658
SMART Domains Protein: ENSMUSP00000106286
Gene: ENSMUSG00000027263

DomainStartEndE-ValueType
Pfam:Spc97_Spc98 4 572 4.1e-115 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000110661
SMART Domains Protein: ENSMUSP00000106289
Gene: ENSMUSG00000050619

DomainStartEndE-ValueType
SCAN 13 125 5.83e-70 SMART
Pfam:Myb_DNA-bind_4 238 323 5.4e-21 PFAM
Pfam:Myb_DNA-bind_4 399 484 7.4e-22 PFAM
low complexity region 518 532 N/A INTRINSIC
ZnF_C2H2 665 687 2.99e-4 SMART
ZnF_C2H2 693 715 2.75e-3 SMART
ZnF_C2H2 721 743 8.02e-5 SMART
ZnF_C2H2 749 771 1.13e-4 SMART
ZnF_C2H2 777 799 1.18e-2 SMART
ZnF_C2H2 805 827 1.33e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130929
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133773
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135555
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138601
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144076
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144123
Predicted Effect probably benign
Transcript: ENSMUST00000146243
SMART Domains Protein: ENSMUSP00000120997
Gene: ENSMUSG00000050619

DomainStartEndE-ValueType
SCAN 13 118 4.23e-58 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154633
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156370
Predicted Effect probably null
Transcript: ENSMUST00000163766
SMART Domains Protein: ENSMUSP00000125987
Gene: ENSMUSG00000050619

DomainStartEndE-ValueType
SCAN 13 125 5.83e-70 SMART
Pfam:Myb_DNA-bind_4 238 323 5.9e-21 PFAM
Pfam:Myb_DNA-bind_4 434 519 1.3e-21 PFAM
low complexity region 553 567 N/A INTRINSIC
ZnF_C2H2 700 722 2.99e-4 SMART
ZnF_C2H2 728 750 2.75e-3 SMART
ZnF_C2H2 756 778 8.02e-5 SMART
ZnF_C2H2 784 806 1.13e-4 SMART
ZnF_C2H2 812 834 1.18e-2 SMART
ZnF_C2H2 840 862 1.33e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186659
SMART Domains Protein: ENSMUSP00000140417
Gene: ENSMUSG00000027263

DomainStartEndE-ValueType
Pfam:Spc97_Spc98 4 572 4.1e-115 PFAM
Meta Mutation Damage Score 0.6584 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 99% (114/115)
Allele List at MGI
Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700128F08Rik A G 9: 8,222,065 noncoding transcript Het
Aars A G 8: 111,043,679 M370V probably benign Het
Abca2 A G 2: 25,438,371 K846R probably damaging Het
Acad9 A T 3: 36,085,525 I425F probably damaging Het
Adhfe1 C A 1: 9,558,238 D278E possibly damaging Het
Afg3l1 G A 8: 123,498,653 V532I probably benign Het
Als2cr12 T C 1: 58,659,282 T326A probably benign Het
Anks6 C T 4: 47,030,795 G601S probably damaging Het
Ano7 G A 1: 93,397,363 V546M possibly damaging Het
Aox2 G A 1: 58,310,095 probably null Het
Asah1 G T 8: 41,360,277 S33* probably null Het
Astn1 C T 1: 158,657,193 S15F possibly damaging Het
Bag4 A T 8: 25,771,244 Y156* probably null Het
Bmpr1b T C 3: 141,845,187 E381G probably damaging Het
Btnl7-ps A G 17: 34,537,118 noncoding transcript Het
Caap1 A T 4: 94,521,060 probably null Het
Card10 C T 15: 78,802,380 probably null Het
Ccp110 T C 7: 118,722,391 V423A possibly damaging Het
Cdc123 A G 2: 5,804,937 L221P possibly damaging Het
Cdh19 A G 1: 110,954,624 V46A possibly damaging Het
Cfap57 A G 4: 118,620,371 F12S probably damaging Het
Clvs1 A G 4: 9,350,857 probably benign Het
Dgkh A T 14: 78,618,637 V199E probably damaging Het
Dhx32 T A 7: 133,738,655 probably benign Het
Dpf3 G T 12: 83,370,611 S29* probably null Het
Efcab7 C A 4: 99,831,543 S87R probably damaging Het
Fam81a G A 9: 70,093,590 Q291* probably null Het
Fbxo41 G T 6: 85,477,924 N667K probably damaging Het
Gm10313 A T 8: 46,255,425 noncoding transcript Het
Gm1966 A T 7: 106,600,657 noncoding transcript Het
Gm28051 G A 12: 102,720,171 Q77* probably null Het
Gm5535 T A 2: 144,174,649 noncoding transcript Het
Gtf2ird1 A T 5: 134,402,184 D339E probably damaging Het
Igfbp7 A G 5: 77,407,761 M85T possibly damaging Het
Il20ra A G 10: 19,758,943 T311A possibly damaging Het
Il24 T C 1: 130,883,442 probably null Het
Itch T C 2: 155,185,593 F379L possibly damaging Het
Itgad T A 7: 128,189,843 V488D possibly damaging Het
Itpr2 A T 6: 146,233,991 M1814K possibly damaging Het
Kirrel3 A G 9: 34,944,439 E92G possibly damaging Het
Lpin2 T C 17: 71,231,334 V325A probably damaging Het
Lrba C T 3: 86,225,371 T28M probably benign Het
Lrch3 T C 16: 32,998,513 Y661H probably damaging Het
Lrfn5 C A 12: 61,839,675 S83Y probably damaging Het
Lrp1 A C 10: 127,539,520 L4435R probably benign Het
Lrrn1 A G 6: 107,569,344 D701G probably benign Het
Map4k3 A T 17: 80,653,903 Y125N probably benign Het
Mau2 A T 8: 70,027,703 H273Q possibly damaging Het
Med16 A C 10: 79,907,037 probably null Het
Mmp17 A G 5: 129,602,165 H376R possibly damaging Het
Nlrp12 G A 7: 3,240,983 H300Y possibly damaging Het
Nlrp3 A T 11: 59,548,728 Y377F probably damaging Het
Notch2 T C 3: 98,101,636 probably null Het
Nudcd1 A T 15: 44,376,643 C500* probably null Het
Olfr1099 A T 2: 86,959,354 Y35N probably damaging Het
Olfr1164 A G 2: 88,093,009 V309A probably damaging Het
Olfr619 T C 7: 103,603,990 I112T probably damaging Het
Olfr711 T A 7: 106,971,571 M258L probably benign Het
Olfr937 A T 9: 39,060,531 M45K probably benign Het
Pcdhb20 T A 18: 37,506,771 N783K probably benign Het
Pclo T A 5: 14,677,882 probably benign Het
Pdyn T A 2: 129,688,101 D216V probably damaging Het
Phldb3 A T 7: 24,624,685 I495F possibly damaging Het
Pmpca A T 2: 26,395,166 I468F probably damaging Het
Pmpcb G A 5: 21,756,443 R399H probably damaging Het
Polrmt G T 10: 79,736,587 H1145N probably damaging Het
Proser1 A G 3: 53,464,306 D11G probably damaging Het
Ptprc A G 1: 138,094,299 S544P probably damaging Het
Ptprn2 G A 12: 117,276,595 E991K probably damaging Het
Pwp2 A C 10: 78,173,693 L797R possibly damaging Het
Rbm20 G A 19: 53,851,669 A1030T probably damaging Het
Rdh7 T C 10: 127,885,822 Y195C probably benign Het
Rev3l T A 10: 39,823,330 D1274E probably benign Het
Scfd2 G T 5: 74,206,321 H639Q probably benign Het
Sell T A 1: 164,065,318 H34Q possibly damaging Het
Senp8 A C 9: 59,737,221 D204E probably benign Het
Setd2 A G 9: 110,548,158 D347G probably benign Het
Sh2b1 T A 7: 126,468,803 R560W probably damaging Het
Slc36a3 T A 11: 55,148,573 K76N probably damaging Het
Slc6a9 A T 4: 117,856,008 Y60F probably damaging Het
Slfn10-ps C T 11: 83,030,381 noncoding transcript Het
Spata31d1d G A 13: 59,727,520 H734Y probably benign Het
Spsb1 T A 4: 149,907,155 probably benign Het
Sptbn5 T A 2: 120,051,777 noncoding transcript Het
Sugp2 G A 8: 70,259,812 V1026I possibly damaging Het
Syt14 T A 1: 192,930,977 probably benign Het
Sytl1 G A 4: 133,255,582 Q373* probably null Het
Tex43 G T 18: 56,592,422 M46I possibly damaging Het
Trim38 T A 13: 23,791,329 L417Q probably damaging Het
Ttll1 T C 15: 83,496,396 H256R probably damaging Het
Ttyh2 A T 11: 114,696,757 T195S probably benign Het
Unc119b A G 5: 115,125,494 L217P probably damaging Het
Usp6nl A G 2: 6,420,903 K152E probably benign Het
Vcam1 T C 3: 116,117,292 R486G probably benign Het
Vmn1r225 G A 17: 20,502,569 G91S possibly damaging Het
Vmn2r1 A C 3: 64,090,123 Q400P possibly damaging Het
Vmn2r87 A T 10: 130,478,553 L388Q probably damaging Het
Wnk1 A T 6: 119,965,735 probably benign Het
Zfp239 A G 6: 117,870,517 probably benign Het
Zfp688 T C 7: 127,419,155 Y266C probably damaging Het
Zfp850 A T 7: 27,990,233 C183* probably null Het
Other mutations in Zscan29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01935:Zscan29 APN 2 121170057 missense probably damaging 1.00
IGL01938:Zscan29 APN 2 121166209 missense probably benign 0.16
IGL02220:Zscan29 APN 2 121166689 missense probably damaging 0.99
IGL02370:Zscan29 APN 2 121163833 missense probably benign 0.00
IGL02585:Zscan29 APN 2 121163876 nonsense probably null
R0284:Zscan29 UTSW 2 121166733 unclassified probably benign
R0842:Zscan29 UTSW 2 121161479 missense possibly damaging 0.84
R1245:Zscan29 UTSW 2 121166503 missense probably damaging 1.00
R1586:Zscan29 UTSW 2 121161160 missense probably damaging 1.00
R1654:Zscan29 UTSW 2 121164779 missense probably benign 0.06
R1958:Zscan29 UTSW 2 121169808 critical splice donor site probably null
R2073:Zscan29 UTSW 2 121160855 nonsense probably null
R2085:Zscan29 UTSW 2 121169946 nonsense probably null
R2145:Zscan29 UTSW 2 121170106 missense probably damaging 1.00
R2201:Zscan29 UTSW 2 121169402 missense probably damaging 1.00
R2875:Zscan29 UTSW 2 121164100 missense probably damaging 1.00
R2876:Zscan29 UTSW 2 121164100 missense probably damaging 1.00
R3861:Zscan29 UTSW 2 121160731 missense probably benign 0.01
R4244:Zscan29 UTSW 2 121164794 unclassified probably null
R4245:Zscan29 UTSW 2 121164794 unclassified probably null
R4447:Zscan29 UTSW 2 121169886 unclassified probably null
R4662:Zscan29 UTSW 2 121166615 missense probably benign 0.26
R4757:Zscan29 UTSW 2 121160911 missense possibly damaging 0.92
R4777:Zscan29 UTSW 2 121169324 missense probably damaging 0.96
R4905:Zscan29 UTSW 2 121161383 missense possibly damaging 0.53
R5860:Zscan29 UTSW 2 121164037 missense probably damaging 1.00
R5861:Zscan29 UTSW 2 121164037 missense probably damaging 1.00
R5862:Zscan29 UTSW 2 121164037 missense probably damaging 1.00
R5916:Zscan29 UTSW 2 121164037 missense probably damaging 1.00
R5917:Zscan29 UTSW 2 121164037 missense probably damaging 1.00
R5918:Zscan29 UTSW 2 121164037 missense probably damaging 1.00
R6335:Zscan29 UTSW 2 121161436 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- GGGTCTAGAAAATAAGCATCTATCACC -3'
(R):5'- ACTCGGAGAAGATGACACCC -3'

Sequencing Primer
(F):5'- TCCGATTATAGTGAGAACTAGGC -3'
(R):5'- GGAGAAGATGACACCCCTGAAATC -3'
Posted On2016-04-27