Incidental Mutation 'R4970:1700128F08Rik'
List |< first << previous [record 26 of 1920] next >> last >|
ID384388
Institutional Source Beutler Lab
Gene Symbol 1700128F08Rik
Ensembl Gene ENSMUSG00000031998
Gene NameRIKEN cDNA 1700128F08 gene
Synonyms
MMRRC Submission 042565-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.933) question?
Stock #R4970 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location8221889-8241987 bp(+) (GRCm38)
Type of Mutationexon
DNA Base Change (assembly) A to G at 8222065 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model
Predicted Effect noncoding transcript
Transcript: ENSMUST00000034483
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213708
Meta Mutation Damage Score 0.424 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 99% (114/115)
Allele List at MGI
Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars A G 8: 111,043,679 M370V probably benign Het
Abca2 A G 2: 25,438,371 K846R probably damaging Het
Acad9 A T 3: 36,085,525 I425F probably damaging Het
Adhfe1 C A 1: 9,558,238 D278E possibly damaging Het
Afg3l1 G A 8: 123,498,653 V532I probably benign Het
Als2cr12 T C 1: 58,659,282 T326A probably benign Het
Anks6 C T 4: 47,030,795 G601S probably damaging Het
Ano7 G A 1: 93,397,363 V546M possibly damaging Het
Aox2 G A 1: 58,310,095 probably null Het
Asah1 G T 8: 41,360,277 S33* probably null Het
Astn1 C T 1: 158,657,193 S15F possibly damaging Het
Bag4 A T 8: 25,771,244 Y156* probably null Het
Bmpr1b T C 3: 141,845,187 E381G probably damaging Het
Btnl7-ps A G 17: 34,537,118 noncoding transcript Het
Caap1 A T 4: 94,521,060 probably null Het
Card10 C T 15: 78,802,380 probably null Het
Ccp110 T C 7: 118,722,391 V423A possibly damaging Het
Cdc123 A G 2: 5,804,937 L221P possibly damaging Het
Cdh19 A G 1: 110,954,624 V46A possibly damaging Het
Cfap57 A G 4: 118,620,371 F12S probably damaging Het
Clvs1 A G 4: 9,350,857 probably benign Het
Dgkh A T 14: 78,618,637 V199E probably damaging Het
Dhx32 T A 7: 133,738,655 probably benign Het
Dpf3 G T 12: 83,370,611 S29* probably null Het
Efcab7 C A 4: 99,831,543 S87R probably damaging Het
Fam81a G A 9: 70,093,590 Q291* probably null Het
Fbxo41 G T 6: 85,477,924 N667K probably damaging Het
Gm10313 A T 8: 46,255,425 noncoding transcript Het
Gm1966 A T 7: 106,600,657 noncoding transcript Het
Gm28051 G A 12: 102,720,171 Q77* probably null Het
Gm5535 T A 2: 144,174,649 noncoding transcript Het
Gtf2ird1 A T 5: 134,402,184 D339E probably damaging Het
Igfbp7 A G 5: 77,407,761 M85T possibly damaging Het
Il20ra A G 10: 19,758,943 T311A possibly damaging Het
Il24 T C 1: 130,883,442 probably null Het
Itch T C 2: 155,185,593 F379L possibly damaging Het
Itgad T A 7: 128,189,843 V488D possibly damaging Het
Itpr2 A T 6: 146,233,991 M1814K possibly damaging Het
Kirrel3 A G 9: 34,944,439 E92G possibly damaging Het
Lpin2 T C 17: 71,231,334 V325A probably damaging Het
Lrba C T 3: 86,225,371 T28M probably benign Het
Lrch3 T C 16: 32,998,513 Y661H probably damaging Het
Lrfn5 C A 12: 61,839,675 S83Y probably damaging Het
Lrp1 A C 10: 127,539,520 L4435R probably benign Het
Lrrn1 A G 6: 107,569,344 D701G probably benign Het
Map4k3 A T 17: 80,653,903 Y125N probably benign Het
Mau2 A T 8: 70,027,703 H273Q possibly damaging Het
Med16 A C 10: 79,907,037 probably null Het
Mmp17 A G 5: 129,602,165 H376R possibly damaging Het
Nlrp12 G A 7: 3,240,983 H300Y possibly damaging Het
Nlrp3 A T 11: 59,548,728 Y377F probably damaging Het
Notch2 T C 3: 98,101,636 probably null Het
Nudcd1 A T 15: 44,376,643 C500* probably null Het
Olfr1099 A T 2: 86,959,354 Y35N probably damaging Het
Olfr1164 A G 2: 88,093,009 V309A probably damaging Het
Olfr619 T C 7: 103,603,990 I112T probably damaging Het
Olfr711 T A 7: 106,971,571 M258L probably benign Het
Olfr937 A T 9: 39,060,531 M45K probably benign Het
Pcdhb20 T A 18: 37,506,771 N783K probably benign Het
Pclo T A 5: 14,677,882 probably benign Het
Pdyn T A 2: 129,688,101 D216V probably damaging Het
Phldb3 A T 7: 24,624,685 I495F possibly damaging Het
Pmpca A T 2: 26,395,166 I468F probably damaging Het
Pmpcb G A 5: 21,756,443 R399H probably damaging Het
Polrmt G T 10: 79,736,587 H1145N probably damaging Het
Proser1 A G 3: 53,464,306 D11G probably damaging Het
Ptprc A G 1: 138,094,299 S544P probably damaging Het
Ptprn2 G A 12: 117,276,595 E991K probably damaging Het
Pwp2 A C 10: 78,173,693 L797R possibly damaging Het
Rbm20 G A 19: 53,851,669 A1030T probably damaging Het
Rdh7 T C 10: 127,885,822 Y195C probably benign Het
Rev3l T A 10: 39,823,330 D1274E probably benign Het
Scfd2 G T 5: 74,206,321 H639Q probably benign Het
Sell T A 1: 164,065,318 H34Q possibly damaging Het
Senp8 A C 9: 59,737,221 D204E probably benign Het
Setd2 A G 9: 110,548,158 D347G probably benign Het
Sh2b1 T A 7: 126,468,803 R560W probably damaging Het
Slc36a3 T A 11: 55,148,573 K76N probably damaging Het
Slc6a9 A T 4: 117,856,008 Y60F probably damaging Het
Slfn10-ps C T 11: 83,030,381 noncoding transcript Het
Spata31d1d G A 13: 59,727,520 H734Y probably benign Het
Spsb1 T A 4: 149,907,155 probably benign Het
Sptbn5 T A 2: 120,051,777 noncoding transcript Het
Sugp2 G A 8: 70,259,812 V1026I possibly damaging Het
Syt14 T A 1: 192,930,977 probably benign Het
Sytl1 G A 4: 133,255,582 Q373* probably null Het
Tex43 G T 18: 56,592,422 M46I possibly damaging Het
Trim38 T A 13: 23,791,329 L417Q probably damaging Het
Ttll1 T C 15: 83,496,396 H256R probably damaging Het
Ttyh2 A T 11: 114,696,757 T195S probably benign Het
Unc119b A G 5: 115,125,494 L217P probably damaging Het
Usp6nl A G 2: 6,420,903 K152E probably benign Het
Vcam1 T C 3: 116,117,292 R486G probably benign Het
Vmn1r225 G A 17: 20,502,569 G91S possibly damaging Het
Vmn2r1 A C 3: 64,090,123 Q400P possibly damaging Het
Vmn2r87 A T 10: 130,478,553 L388Q probably damaging Het
Wnk1 A T 6: 119,965,735 probably benign Het
Zfp239 A G 6: 117,870,517 probably benign Het
Zfp688 T C 7: 127,419,155 Y266C probably damaging Het
Zfp850 A T 7: 27,990,233 C183* probably null Het
Zscan29 T C 2: 121,169,195 probably null Het
Other mutations in 1700128F08Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0472:1700128F08Rik UTSW 9 8222122 exon noncoding transcript
R1114:1700128F08Rik UTSW 9 8222178 exon noncoding transcript
R4732:1700128F08Rik UTSW 9 8222173 exon noncoding transcript
R4733:1700128F08Rik UTSW 9 8222173 exon noncoding transcript
R5692:1700128F08Rik UTSW 9 8221990 exon noncoding transcript
R5699:1700128F08Rik UTSW 9 8225319 unclassified noncoding transcript
Predicted Primers PCR Primer
(F):5'- ATAGCTGGAACCTGGGTACG -3'
(R):5'- CTCCTTGTACTCAATGAAGGCG -3'

Sequencing Primer
(F):5'- TTCACGCCGGCAGTTCC -3'
(R):5'- GTAGCCCTTGGAGAAGCCTGTC -3'
Posted On2016-04-27