Incidental Mutation 'R4970:Nlrp3'
ID384403
Institutional Source Beutler Lab
Gene Symbol Nlrp3
Ensembl Gene ENSMUSG00000032691
Gene NameNLR family, pyrin domain containing 3
SynonymsCias1, cryopyrin, Pypaf1, NALP3, Mmig1
MMRRC Submission 042565-MU
Accession Numbers

Ncbi RefSeq: NM_145827.3; MGI:2653833

Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R4970 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location59541568-59566956 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 59548728 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 377 (Y377F)
Ref Sequence ENSEMBL: ENSMUSP00000098707 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079476] [ENSMUST00000101148] [ENSMUST00000149126]
Predicted Effect probably damaging
Transcript: ENSMUST00000079476
AA Change: Y377F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078440
Gene: ENSMUSG00000032691
AA Change: Y377F

DomainStartEndE-ValueType
PYRIN 4 87 6.39e-33 SMART
FISNA 135 206 1.45e-22 SMART
Pfam:NACHT 216 385 6.7e-52 PFAM
low complexity region 533 539 N/A INTRINSIC
low complexity region 688 697 N/A INTRINSIC
LRR_RI 737 764 1.07e-9 SMART
LRR 766 793 5.13e1 SMART
LRR 794 821 3.86e-7 SMART
LRR 823 850 1.62e0 SMART
LRR 851 878 3.39e-3 SMART
LRR 880 907 1.2e2 SMART
LRR 908 935 2.24e-3 SMART
LRR 937 964 2.16e2 SMART
LRR 965 992 8.73e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000101148
AA Change: Y377F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098707
Gene: ENSMUSG00000032691
AA Change: Y377F

DomainStartEndE-ValueType
PYRIN 4 87 6.39e-33 SMART
FISNA 135 206 1.45e-22 SMART
Pfam:NACHT 216 385 6.7e-52 PFAM
low complexity region 533 539 N/A INTRINSIC
low complexity region 688 697 N/A INTRINSIC
LRR_RI 737 764 1.07e-9 SMART
LRR 766 793 5.13e1 SMART
LRR 794 821 3.86e-7 SMART
LRR 823 850 1.62e0 SMART
LRR 851 878 3.39e-3 SMART
LRR 880 907 1.2e2 SMART
LRR 908 935 2.24e-3 SMART
LRR 937 964 2.16e2 SMART
LRR 965 992 8.73e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149126
SMART Domains Protein: ENSMUSP00000114231
Gene: ENSMUSG00000032691

DomainStartEndE-ValueType
PYRIN 4 87 6.39e-33 SMART
Pfam:FISNA 135 173 1.6e-12 PFAM
Meta Mutation Damage Score 0.064 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 99% (114/115)
MGI Phenotype Strain: 3686871
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a pyrin-like protein containing a pyrin domain, a nucleotide-binding site (NBS) domain, and a leucine-rich repeat (LRR) motif. This protein interacts with the apoptosis-associated speck-like protein PYCARD/ASC, which contains a caspase recruitment domain, and is a member of the NALP3 inflammasome complex. This complex functions as an upstream activator of NF-kappaB signaling, and it plays a role in the regulation of inflammation, the immune response, and apoptosis. Mutations in this gene are associated with familial cold autoinflammatory syndrome (FCAS), Muckle-Wells syndrome (MWS), chronic infantile neurological cutaneous and articular (CINCA) syndrome, and neonatal-onset multisystem inflammatory disease (NOMID). Multiple alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. Alternative 5' UTR structures are suggested by available data; however, insufficient evidence is available to determine if all of the represented 5' UTR splice patterns are biologically valid. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for null mutations exhibit attenuated inflammatory responses related to decrease secretion of IL-1beta and IL-18. Mice heterozygous for activating mutations suffer from autoinflammatory attacks that lead to organ failure and death before weaning. [provided by MGI curators]
Allele List at MGI

All alleles(13) : Targeted(9) Chemically induced(4)

Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700128F08Rik A G 9: 8,222,065 noncoding transcript Het
Aars A G 8: 111,043,679 M370V probably benign Het
Abca2 A G 2: 25,438,371 K846R probably damaging Het
Acad9 A T 3: 36,085,525 I425F probably damaging Het
Adhfe1 C A 1: 9,558,238 D278E possibly damaging Het
Afg3l1 G A 8: 123,498,653 V532I probably benign Het
Als2cr12 T C 1: 58,659,282 T326A probably benign Het
Anks6 C T 4: 47,030,795 G601S probably damaging Het
Ano7 G A 1: 93,397,363 V546M possibly damaging Het
Aox2 G A 1: 58,310,095 probably null Het
Asah1 G T 8: 41,360,277 S33* probably null Het
Astn1 C T 1: 158,657,193 S15F possibly damaging Het
Bag4 A T 8: 25,771,244 Y156* probably null Het
Bmpr1b T C 3: 141,845,187 E381G probably damaging Het
Btnl7-ps A G 17: 34,537,118 noncoding transcript Het
Caap1 A T 4: 94,521,060 probably null Het
Card10 C T 15: 78,802,380 probably null Het
Ccp110 T C 7: 118,722,391 V423A possibly damaging Het
Cdc123 A G 2: 5,804,937 L221P possibly damaging Het
Cdh19 A G 1: 110,954,624 V46A possibly damaging Het
Cfap57 A G 4: 118,620,371 F12S probably damaging Het
Clvs1 A G 4: 9,350,857 probably benign Het
Dgkh A T 14: 78,618,637 V199E probably damaging Het
Dhx32 T A 7: 133,738,655 probably benign Het
Dpf3 G T 12: 83,370,611 S29* probably null Het
Efcab7 C A 4: 99,831,543 S87R probably damaging Het
Fam81a G A 9: 70,093,590 Q291* probably null Het
Fbxo41 G T 6: 85,477,924 N667K probably damaging Het
Gm10313 A T 8: 46,255,425 noncoding transcript Het
Gm1966 A T 7: 106,600,657 noncoding transcript Het
Gm28051 G A 12: 102,720,171 Q77* probably null Het
Gm5535 T A 2: 144,174,649 noncoding transcript Het
Gtf2ird1 A T 5: 134,402,184 D339E probably damaging Het
Igfbp7 A G 5: 77,407,761 M85T possibly damaging Het
Il20ra A G 10: 19,758,943 T311A possibly damaging Het
Il24 T C 1: 130,883,442 probably null Het
Itch T C 2: 155,185,593 F379L possibly damaging Het
Itgad T A 7: 128,189,843 V488D possibly damaging Het
Itpr2 A T 6: 146,233,991 M1814K possibly damaging Het
Kirrel3 A G 9: 34,944,439 E92G possibly damaging Het
Lpin2 T C 17: 71,231,334 V325A probably damaging Het
Lrba C T 3: 86,225,371 T28M probably benign Het
Lrch3 T C 16: 32,998,513 Y661H probably damaging Het
Lrfn5 C A 12: 61,839,675 S83Y probably damaging Het
Lrp1 A C 10: 127,539,520 L4435R probably benign Het
Lrrn1 A G 6: 107,569,344 D701G probably benign Het
Map4k3 A T 17: 80,653,903 Y125N probably benign Het
Mau2 A T 8: 70,027,703 H273Q possibly damaging Het
Med16 A C 10: 79,907,037 probably null Het
Mmp17 A G 5: 129,602,165 H376R possibly damaging Het
Nlrp12 G A 7: 3,240,983 H300Y possibly damaging Het
Notch2 T C 3: 98,101,636 probably null Het
Nudcd1 A T 15: 44,376,643 C500* probably null Het
Olfr1099 A T 2: 86,959,354 Y35N probably damaging Het
Olfr1164 A G 2: 88,093,009 V309A probably damaging Het
Olfr619 T C 7: 103,603,990 I112T probably damaging Het
Olfr711 T A 7: 106,971,571 M258L probably benign Het
Olfr937 A T 9: 39,060,531 M45K probably benign Het
Pcdhb20 T A 18: 37,506,771 N783K probably benign Het
Pclo T A 5: 14,677,882 probably benign Het
Pdyn T A 2: 129,688,101 D216V probably damaging Het
Phldb3 A T 7: 24,624,685 I495F possibly damaging Het
Pmpca A T 2: 26,395,166 I468F probably damaging Het
Pmpcb G A 5: 21,756,443 R399H probably damaging Het
Polrmt G T 10: 79,736,587 H1145N probably damaging Het
Proser1 A G 3: 53,464,306 D11G probably damaging Het
Ptprc A G 1: 138,094,299 S544P probably damaging Het
Ptprn2 G A 12: 117,276,595 E991K probably damaging Het
Pwp2 A C 10: 78,173,693 L797R possibly damaging Het
Rbm20 G A 19: 53,851,669 A1030T probably damaging Het
Rdh7 T C 10: 127,885,822 Y195C probably benign Het
Rev3l T A 10: 39,823,330 D1274E probably benign Het
Scfd2 G T 5: 74,206,321 H639Q probably benign Het
Sell T A 1: 164,065,318 H34Q possibly damaging Het
Senp8 A C 9: 59,737,221 D204E probably benign Het
Setd2 A G 9: 110,548,158 D347G probably benign Het
Sh2b1 T A 7: 126,468,803 R560W probably damaging Het
Slc36a3 T A 11: 55,148,573 K76N probably damaging Het
Slc6a9 A T 4: 117,856,008 Y60F probably damaging Het
Slfn10-ps C T 11: 83,030,381 noncoding transcript Het
Spata31d1d G A 13: 59,727,520 H734Y probably benign Het
Spsb1 T A 4: 149,907,155 probably benign Het
Sptbn5 T A 2: 120,051,777 noncoding transcript Het
Sugp2 G A 8: 70,259,812 V1026I possibly damaging Het
Syt14 T A 1: 192,930,977 probably benign Het
Sytl1 G A 4: 133,255,582 Q373* probably null Het
Tex43 G T 18: 56,592,422 M46I possibly damaging Het
Trim38 T A 13: 23,791,329 L417Q probably damaging Het
Ttll1 T C 15: 83,496,396 H256R probably damaging Het
Ttyh2 A T 11: 114,696,757 T195S probably benign Het
Unc119b A G 5: 115,125,494 L217P probably damaging Het
Usp6nl A G 2: 6,420,903 K152E probably benign Het
Vcam1 T C 3: 116,117,292 R486G probably benign Het
Vmn1r225 G A 17: 20,502,569 G91S possibly damaging Het
Vmn2r1 A C 3: 64,090,123 Q400P possibly damaging Het
Vmn2r87 A T 10: 130,478,553 L388Q probably damaging Het
Wnk1 A T 6: 119,965,735 probably benign Het
Zfp239 A G 6: 117,870,517 probably benign Het
Zfp688 T C 7: 127,419,155 Y266C probably damaging Het
Zfp850 A T 7: 27,990,233 C183* probably null Het
Zscan29 T C 2: 121,169,195 probably null Het
Other mutations in Nlrp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Nlrp3 APN 11 59565943 missense probably damaging 0.99
IGL00573:Nlrp3 APN 11 59565116 missense possibly damaging 0.93
IGL01025:Nlrp3 APN 11 59551887 missense probably benign 0.21
IGL01637:Nlrp3 APN 11 59549378 missense probably damaging 0.99
IGL02010:Nlrp3 APN 11 59549535 missense probably benign
IGL02334:Nlrp3 APN 11 59565083 missense probably benign
IGL02417:Nlrp3 APN 11 59566023 unclassified probably benign
IGL02578:Nlrp3 APN 11 59548401 missense probably damaging 1.00
IGL02710:Nlrp3 APN 11 59565976 missense probably damaging 0.99
IGL02816:Nlrp3 APN 11 59555782 missense probably benign 0.03
IGL03157:Nlrp3 APN 11 59549546 missense possibly damaging 0.80
IGL03334:Nlrp3 APN 11 59549016 missense probably damaging 1.00
Flogiston UTSW 11 59558448 missense probably benign 0.00
nd1 UTSW 11 59565974 missense probably benign 0.45
Nd14 UTSW 11 59555875 missense possibly damaging 0.89
Nd3 UTSW 11 59565974 missense probably benign 0.45
nd5 UTSW 11 59565879 missense probably benign 0.01
nd6 UTSW 11 59549354 missense probably damaging 1.00
nd7 UTSW 11 59555875 missense possibly damaging 0.89
Nd9 UTSW 11 59549354 missense probably damaging 1.00
Park2 UTSW 11 59565128 nonsense probably null
Park3 UTSW 11 59565850 missense probably benign 0.02
Park4 UTSW 11 59549531 missense probably benign 0.19
Park5 UTSW 11 59548476 missense probably damaging 0.99
Park6 UTSW 11 59549036 missense probably damaging 1.00
Park7 UTSW 11 59548010 nonsense probably null
Park8 UTSW 11 59566199 missense probably benign 0.19
R0008:Nlrp3 UTSW 11 59558448 missense probably benign 0.00
R0008:Nlrp3 UTSW 11 59558448 missense probably benign 0.00
R0052:Nlrp3 UTSW 11 59565128 nonsense probably null
R0362:Nlrp3 UTSW 11 59548797 missense possibly damaging 0.49
R0416:Nlrp3 UTSW 11 59555924 splice site probably benign
R0649:Nlrp3 UTSW 11 59548542 missense possibly damaging 0.83
R0740:Nlrp3 UTSW 11 59548256 missense probably benign 0.01
R0863:Nlrp3 UTSW 11 59565850 missense probably benign 0.02
R1300:Nlrp3 UTSW 11 59555768 missense possibly damaging 0.86
R1414:Nlrp3 UTSW 11 59549531 missense probably benign 0.19
R1622:Nlrp3 UTSW 11 59548476 missense probably damaging 0.99
R1654:Nlrp3 UTSW 11 59543123 missense probably benign 0.03
R1715:Nlrp3 UTSW 11 59543351 missense probably damaging 1.00
R1754:Nlrp3 UTSW 11 59558402 missense possibly damaging 0.80
R1837:Nlrp3 UTSW 11 59548916 missense probably benign 0.00
R1905:Nlrp3 UTSW 11 59549036 missense probably damaging 1.00
R2281:Nlrp3 UTSW 11 59549136 missense possibly damaging 0.70
R4296:Nlrp3 UTSW 11 59549661 missense possibly damaging 0.89
R4305:Nlrp3 UTSW 11 59548010 nonsense probably null
R4540:Nlrp3 UTSW 11 59551899 missense possibly damaging 0.83
R4591:Nlrp3 UTSW 11 59549222 missense probably benign 0.00
R4816:Nlrp3 UTSW 11 59548301 missense probably benign 0.32
R4913:Nlrp3 UTSW 11 59549238 missense probably benign 0.09
R5051:Nlrp3 UTSW 11 59566199 missense probably benign 0.19
R5112:Nlrp3 UTSW 11 59548728 missense probably damaging 1.00
R5185:Nlrp3 UTSW 11 59565084 missense probably benign 0.05
R5417:Nlrp3 UTSW 11 59549063 missense probably damaging 1.00
R5709:Nlrp3 UTSW 11 59555748 nonsense probably null
R5869:Nlrp3 UTSW 11 59548134 missense probably damaging 1.00
R5898:Nlrp3 UTSW 11 59546852 missense probably benign 0.00
R5953:Nlrp3 UTSW 11 59546791 missense probably benign
R5979:Nlrp3 UTSW 11 59548971 missense probably benign 0.06
R6359:Nlrp3 UTSW 11 59548566 missense probably damaging 0.97
R6723:Nlrp3 UTSW 11 59565192 missense probably damaging 1.00
Z1088:Nlrp3 UTSW 11 59551860 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- CAGACTGGCAAAAGGCTGTG -3'
(R):5'- AGAGATGCTCCTCAATGCCC -3'

Sequencing Primer
(F):5'- TGCGGGGAGACATTCTGCTAAG -3'
(R):5'- ACGTAGACGGCCGTAGTG -3'
Posted On2016-04-27