Incidental Mutation 'R4971:Rhot1'
ID384459
Institutional Source Beutler Lab
Gene Symbol Rhot1
Ensembl Gene ENSMUSG00000017686
Gene Nameras homolog family member T1
Synonyms2210403N23Rik, Arht1, C430039G08Rik, FLJ11040, Miro1
MMRRC Submission 042566-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4971 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location80209019-80267907 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 80233474 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 154 (I154K)
Ref Sequence ENSEMBL: ENSMUSP00000090533 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017831] [ENSMUST00000055056] [ENSMUST00000077451] [ENSMUST00000092857]
Predicted Effect probably damaging
Transcript: ENSMUST00000017831
AA Change: I154K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000017831
Gene: ENSMUSG00000017686
AA Change: I154K

DomainStartEndE-ValueType
Pfam:Arf 7 177 5.5e-6 PFAM
Pfam:Miro 19 134 2.5e-18 PFAM
Pfam:Ras 19 181 1.4e-20 PFAM
EFh 201 229 6.75e0 SMART
Pfam:EF_assoc_2 231 319 5.3e-36 PFAM
EFh 321 349 1.67e0 SMART
Pfam:EF_assoc_1 353 427 1.8e-33 PFAM
Pfam:Miro 433 543 6.6e-16 PFAM
Pfam:Ras 433 566 1.7e-6 PFAM
transmembrane domain 638 660 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000055056
AA Change: I154K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000057669
Gene: ENSMUSG00000017686
AA Change: I154K

DomainStartEndE-ValueType
Pfam:Arf 7 177 5.6e-6 PFAM
Pfam:Miro 19 134 2.5e-18 PFAM
Pfam:Ras 19 181 1.4e-20 PFAM
EFh 201 229 6.75e0 SMART
Pfam:EF_assoc_2 231 319 5.4e-36 PFAM
EFh 321 349 1.67e0 SMART
Pfam:EF_assoc_1 353 427 1.8e-33 PFAM
Pfam:Miro 433 543 6.7e-16 PFAM
Pfam:Ras 433 577 1.6e-6 PFAM
transmembrane domain 647 669 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000077451
AA Change: I154K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000076664
Gene: ENSMUSG00000017686
AA Change: I154K

DomainStartEndE-ValueType
Pfam:Roc 19 135 9.4e-11 PFAM
Pfam:Ras 19 181 9.1e-21 PFAM
EFh 201 229 6.75e0 SMART
Pfam:EF_assoc_2 232 318 8.3e-36 PFAM
EFh 321 349 1.67e0 SMART
Pfam:EF_assoc_1 354 426 7e-32 PFAM
Pfam:Ras 433 566 1.5e-6 PFAM
transmembrane domain 679 701 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000092857
AA Change: I154K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000090533
Gene: ENSMUSG00000017686
AA Change: I154K

DomainStartEndE-ValueType
small_GTPase 15 182 5.1e-8 SMART
EFh 201 229 3.3e-2 SMART
Pfam:EF_assoc_2 231 319 2.9e-33 PFAM
EFh 321 349 8.1e-3 SMART
Pfam:EF_assoc_1 353 427 1e-30 PFAM
Pfam:Miro 433 543 8e-15 PFAM
Pfam:Ras 433 566 2.5e-5 PFAM
transmembrane domain 606 628 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134148
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154362
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 89.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele die neonatally exhibiting cyanosis, respiratory failure, loss of brainstem cranial motor neurons, decreased cervical motor neuron number and phrenic nerve branching, and alterations in retrograde mitochondrial transport and run length in cortical axons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T C 6: 149,325,599 probably benign Het
A2ml1 A T 6: 128,547,227 F1147L probably damaging Het
Abca2 T C 2: 25,441,994 S1373P probably damaging Het
Abca9 A T 11: 110,152,048 S392T probably benign Het
Abcd2 T C 15: 91,163,110 D580G probably benign Het
Actl9 T A 17: 33,433,908 L314H probably damaging Het
Adamtsl1 T C 4: 86,336,931 F746L probably damaging Het
Anks6 C T 4: 47,030,795 G601S probably damaging Het
Cd3eap T C 7: 19,357,562 N207D probably benign Het
Cdkl3 T C 11: 52,011,168 V68A possibly damaging Het
Cnot1 A G 8: 95,721,626 F2266S probably damaging Het
Colq T C 14: 31,545,077 R159G probably damaging Het
Ctse A T 1: 131,664,392 D152V probably damaging Het
Cul7 G T 17: 46,659,119 M1011I probably benign Het
Cyb5r4 G T 9: 87,057,171 V336L possibly damaging Het
Dync2h1 A T 9: 7,131,949 H1619Q probably benign Het
Eif2ak1 A G 5: 143,882,168 K216E probably damaging Het
F5 A T 1: 164,194,186 H1410L probably benign Het
Frem2 T C 3: 53,539,183 Y2388C probably damaging Het
Fsip2 C T 2: 82,985,878 T3985M probably benign Het
Gak T C 5: 108,596,806 Y535C probably damaging Het
Gm15448 T A 7: 3,822,806 M355L probably benign Het
Gzmc G T 14: 56,232,369 P158Q probably damaging Het
Hook3 A G 8: 26,082,579 Y135H probably benign Het
Ikbke GCC G 1: 131,275,267 probably null Het
Ing4 A T 6: 125,043,998 M28L probably benign Het
Irs3 T A 5: 137,644,492 D228V probably damaging Het
Jade1 T A 3: 41,601,401 I301N probably damaging Het
Kif13b T A 14: 64,757,562 M921K possibly damaging Het
Kmt2c A G 5: 25,310,872 S2658P probably benign Het
Map3k4 A G 17: 12,249,495 probably null Het
Map4k5 C T 12: 69,852,719 V53I possibly damaging Het
Mdn1 T C 4: 32,739,827 S3694P probably damaging Het
Mgea5 C A 19: 45,770,046 probably null Het
Mroh7 A G 4: 106,691,552 V1038A probably benign Het
Muc5ac T C 7: 141,816,278 V3185A possibly damaging Het
Mup5 T A 4: 61,833,060 N117I probably benign Het
Myo19 T A 11: 84,892,197 M179K probably damaging Het
Myo1c A G 11: 75,671,588 Y902C probably damaging Het
Nf1 T A 11: 79,444,643 I977K probably damaging Het
Nos1 T C 5: 117,943,834 V1240A probably benign Het
Nr3c1 T C 18: 39,486,877 D119G probably damaging Het
Olfr1212 A T 2: 88,958,519 N18Y probably damaging Het
Pdlim2 A G 14: 70,167,759 V219A probably damaging Het
Prdx1 T C 4: 116,691,931 probably null Het
Rbfox1 C T 16: 7,294,088 R173C probably damaging Het
Rbp3 T A 14: 33,954,470 V125D probably damaging Het
Runx1t1 C T 4: 13,837,978 R129C probably damaging Het
Setbp1 A G 18: 78,858,167 S762P probably benign Het
Slc13a3 A G 2: 165,448,699 I67T probably damaging Het
Tbc1d2b A T 9: 90,218,870 M689K probably benign Het
Top2a T C 11: 98,993,841 Y1517C probably damaging Het
Txndc2 A T 17: 65,638,854 N109K probably damaging Het
Tyk2 A G 9: 21,120,501 probably null Het
Wdfy3 A T 5: 101,948,972 L320* probably null Het
Zfp456 T C 13: 67,366,876 E237G probably benign Het
Zscan10 A G 17: 23,607,173 E103G possibly damaging Het
Other mutations in Rhot1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00807:Rhot1 APN 11 80226102 missense probably benign 0.27
IGL01335:Rhot1 APN 11 80250229 missense probably damaging 1.00
IGL01631:Rhot1 APN 11 80265774 missense probably damaging 1.00
IGL03009:Rhot1 APN 11 80220254 splice site probably null
IGL03106:Rhot1 APN 11 80242581 nonsense probably null
R0554:Rhot1 UTSW 11 80243438 nonsense probably null
R0720:Rhot1 UTSW 11 80223943 missense probably damaging 1.00
R1319:Rhot1 UTSW 11 80246021 missense probably damaging 0.98
R3825:Rhot1 UTSW 11 80226081 missense probably damaging 0.98
R4713:Rhot1 UTSW 11 80225602 missense probably benign 0.00
R4917:Rhot1 UTSW 11 80209201 utr 5 prime probably benign
R5159:Rhot1 UTSW 11 80220272 missense probably damaging 1.00
R5177:Rhot1 UTSW 11 80246766 missense possibly damaging 0.90
R5231:Rhot1 UTSW 11 80227334 critical splice donor site probably null
R5659:Rhot1 UTSW 11 80250355 intron probably null
R5941:Rhot1 UTSW 11 80251170 intron probably benign
R6216:Rhot1 UTSW 11 80251059 missense probably benign 0.00
R6920:Rhot1 UTSW 11 80242095 missense probably benign 0.36
R6984:Rhot1 UTSW 11 80233484 nonsense probably null
R7199:Rhot1 UTSW 11 80246734 missense probably damaging 1.00
R7383:Rhot1 UTSW 11 80223934 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACTGAACCTACTATCTGGGGAC -3'
(R):5'- TCCTTTGTGGACAGTACCAAGATC -3'

Sequencing Primer
(F):5'- GCTTGACCAAGTTACGATGGG -3'
(R):5'- TGTGGACAGTACCAAGATCTCCATAG -3'
Posted On2016-04-27