Incidental Mutation 'R4971:Pdlim2'
ID384471
Institutional Source Beutler Lab
Gene Symbol Pdlim2
Ensembl Gene ENSMUSG00000022090
Gene NamePDZ and LIM domain 2
SynonymsSLIM, 4732462F18Rik, mystique
MMRRC Submission 042566-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R4971 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location70164218-70177681 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 70167759 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 219 (V219A)
Ref Sequence ENSEMBL: ENSMUSP00000116200 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022681] [ENSMUST00000127836] [ENSMUST00000129174] [ENSMUST00000143393] [ENSMUST00000153735]
Predicted Effect probably damaging
Transcript: ENSMUST00000022681
AA Change: V219A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022681
Gene: ENSMUSG00000022090
AA Change: V219A

DomainStartEndE-ValueType
PDZ 11 84 3.41e-17 SMART
low complexity region 129 144 N/A INTRINSIC
Pfam:DUF4749 169 256 4.4e-12 PFAM
low complexity region 259 271 N/A INTRINSIC
LIM 282 334 1.25e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123125
Predicted Effect unknown
Transcript: ENSMUST00000125300
AA Change: V20A
SMART Domains Protein: ENSMUSP00000116694
Gene: ENSMUSG00000022090
AA Change: V20A

DomainStartEndE-ValueType
Pfam:DUF4749 7 58 6.4e-13 PFAM
low complexity region 61 73 N/A INTRINSIC
LIM 84 136 1.25e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127836
SMART Domains Protein: ENSMUSP00000141050
Gene: ENSMUSG00000022090

DomainStartEndE-ValueType
low complexity region 20 29 N/A INTRINSIC
low complexity region 38 50 N/A INTRINSIC
LIM 61 113 5.9e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129174
SMART Domains Protein: ENSMUSP00000139820
Gene: ENSMUSG00000022090

DomainStartEndE-ValueType
low complexity region 20 29 N/A INTRINSIC
low complexity region 38 50 N/A INTRINSIC
LIM 61 113 5.9e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135944
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138792
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141363
Predicted Effect probably benign
Transcript: ENSMUST00000143393
SMART Domains Protein: ENSMUSP00000119222
Gene: ENSMUSG00000022090

DomainStartEndE-ValueType
PDZ 11 84 3.41e-17 SMART
low complexity region 129 144 N/A INTRINSIC
low complexity region 199 210 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000153735
AA Change: V219A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116200
Gene: ENSMUSG00000022090
AA Change: V219A

DomainStartEndE-ValueType
PDZ 11 84 3.41e-17 SMART
low complexity region 129 144 N/A INTRINSIC
low complexity region 199 210 N/A INTRINSIC
low complexity region 241 250 N/A INTRINSIC
low complexity region 259 271 N/A INTRINSIC
LIM 282 334 1.25e-6 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 89.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ALP subfamily of PDZ-LIM domain proteins. The encoded protein suppresses anchorage-dependent growth and promotes cell migration and adhesion through interactions with the actin cytoskeleton via the PDZ domain. The encoded protein is also a putative tumor suppressor protein, and decreased expression of this gene is associated with several malignancies including breast cancer and adult T-cell leukemia. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a knock-out allele display increased IFN-gamma production by Th1 cells and an enhanced inflammatory response to in vivo challenge with heat-killed Listeria monocytogenes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T C 6: 149,325,599 probably benign Het
A2ml1 A T 6: 128,547,227 F1147L probably damaging Het
Abca2 T C 2: 25,441,994 S1373P probably damaging Het
Abca9 A T 11: 110,152,048 S392T probably benign Het
Abcd2 T C 15: 91,163,110 D580G probably benign Het
Actl9 T A 17: 33,433,908 L314H probably damaging Het
Adamtsl1 T C 4: 86,336,931 F746L probably damaging Het
Anks6 C T 4: 47,030,795 G601S probably damaging Het
Cd3eap T C 7: 19,357,562 N207D probably benign Het
Cdkl3 T C 11: 52,011,168 V68A possibly damaging Het
Cnot1 A G 8: 95,721,626 F2266S probably damaging Het
Colq T C 14: 31,545,077 R159G probably damaging Het
Ctse A T 1: 131,664,392 D152V probably damaging Het
Cul7 G T 17: 46,659,119 M1011I probably benign Het
Cyb5r4 G T 9: 87,057,171 V336L possibly damaging Het
Dync2h1 A T 9: 7,131,949 H1619Q probably benign Het
Eif2ak1 A G 5: 143,882,168 K216E probably damaging Het
F5 A T 1: 164,194,186 H1410L probably benign Het
Frem2 T C 3: 53,539,183 Y2388C probably damaging Het
Fsip2 C T 2: 82,985,878 T3985M probably benign Het
Gak T C 5: 108,596,806 Y535C probably damaging Het
Gm15448 T A 7: 3,822,806 M355L probably benign Het
Gzmc G T 14: 56,232,369 P158Q probably damaging Het
Hook3 A G 8: 26,082,579 Y135H probably benign Het
Ikbke GCC G 1: 131,275,267 probably null Het
Ing4 A T 6: 125,043,998 M28L probably benign Het
Irs3 T A 5: 137,644,492 D228V probably damaging Het
Jade1 T A 3: 41,601,401 I301N probably damaging Het
Kif13b T A 14: 64,757,562 M921K possibly damaging Het
Kmt2c A G 5: 25,310,872 S2658P probably benign Het
Map3k4 A G 17: 12,249,495 probably null Het
Map4k5 C T 12: 69,852,719 V53I possibly damaging Het
Mdn1 T C 4: 32,739,827 S3694P probably damaging Het
Mgea5 C A 19: 45,770,046 probably null Het
Mroh7 A G 4: 106,691,552 V1038A probably benign Het
Muc5ac T C 7: 141,816,278 V3185A possibly damaging Het
Mup5 T A 4: 61,833,060 N117I probably benign Het
Myo19 T A 11: 84,892,197 M179K probably damaging Het
Myo1c A G 11: 75,671,588 Y902C probably damaging Het
Nf1 T A 11: 79,444,643 I977K probably damaging Het
Nos1 T C 5: 117,943,834 V1240A probably benign Het
Nr3c1 T C 18: 39,486,877 D119G probably damaging Het
Olfr1212 A T 2: 88,958,519 N18Y probably damaging Het
Prdx1 T C 4: 116,691,931 probably null Het
Rbfox1 C T 16: 7,294,088 R173C probably damaging Het
Rbp3 T A 14: 33,954,470 V125D probably damaging Het
Rhot1 T A 11: 80,233,474 I154K probably damaging Het
Runx1t1 C T 4: 13,837,978 R129C probably damaging Het
Setbp1 A G 18: 78,858,167 S762P probably benign Het
Slc13a3 A G 2: 165,448,699 I67T probably damaging Het
Tbc1d2b A T 9: 90,218,870 M689K probably benign Het
Top2a T C 11: 98,993,841 Y1517C probably damaging Het
Txndc2 A T 17: 65,638,854 N109K probably damaging Het
Tyk2 A G 9: 21,120,501 probably null Het
Wdfy3 A T 5: 101,948,972 L320* probably null Het
Zfp456 T C 13: 67,366,876 E237G probably benign Het
Zscan10 A G 17: 23,607,173 E103G possibly damaging Het
Other mutations in Pdlim2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02295:Pdlim2 APN 14 70166083 splice site probably benign
IGL02338:Pdlim2 APN 14 70174457 missense probably damaging 1.00
IGL03286:Pdlim2 APN 14 70174476 missense possibly damaging 0.88
PIT4504001:Pdlim2 UTSW 14 70166130 missense probably benign 0.44
R0751:Pdlim2 UTSW 14 70164779 missense probably damaging 1.00
R0768:Pdlim2 UTSW 14 70164779 missense probably damaging 1.00
R0832:Pdlim2 UTSW 14 70164779 missense probably damaging 1.00
R1167:Pdlim2 UTSW 14 70164779 missense probably damaging 1.00
R1207:Pdlim2 UTSW 14 70164779 missense probably damaging 1.00
R1207:Pdlim2 UTSW 14 70164779 missense probably damaging 1.00
R1343:Pdlim2 UTSW 14 70164779 missense probably damaging 1.00
R1412:Pdlim2 UTSW 14 70174324 splice site probably benign
R1595:Pdlim2 UTSW 14 70164744 missense probably damaging 1.00
R1689:Pdlim2 UTSW 14 70171239 missense probably damaging 0.98
R1703:Pdlim2 UTSW 14 70174335 critical splice donor site probably null
R1843:Pdlim2 UTSW 14 70164779 missense probably damaging 1.00
R1845:Pdlim2 UTSW 14 70164779 missense probably damaging 1.00
R1923:Pdlim2 UTSW 14 70164779 missense probably damaging 1.00
R1924:Pdlim2 UTSW 14 70164779 missense probably damaging 1.00
R1925:Pdlim2 UTSW 14 70164779 missense probably damaging 1.00
R2004:Pdlim2 UTSW 14 70164779 missense probably damaging 1.00
R2005:Pdlim2 UTSW 14 70164779 missense probably damaging 1.00
R2202:Pdlim2 UTSW 14 70164779 missense probably damaging 1.00
R2205:Pdlim2 UTSW 14 70164779 missense probably damaging 1.00
R2237:Pdlim2 UTSW 14 70171249 missense probably benign 0.05
R2843:Pdlim2 UTSW 14 70166100 missense probably benign 0.02
R4042:Pdlim2 UTSW 14 70164779 missense probably damaging 1.00
R4965:Pdlim2 UTSW 14 70168015 unclassified probably benign
R5951:Pdlim2 UTSW 14 70167780 missense probably benign 0.06
R6252:Pdlim2 UTSW 14 70167688 missense probably damaging 1.00
R7208:Pdlim2 UTSW 14 70174377 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGCCATGGATCCTTAAGCTAC -3'
(R):5'- GTTCAGGTACTAGCAGGTCTTG -3'

Sequencing Primer
(F):5'- ATGGATCCTTAAGCTACTTCCTTAG -3'
(R):5'- GCAGAGTTGGGTGAGCTCC -3'
Posted On2016-04-27