Incidental Mutation 'R4972:Il18r1'
ID384482
Institutional Source Beutler Lab
Gene Symbol Il18r1
Ensembl Gene ENSMUSG00000026070
Gene Nameinterleukin 18 receptor 1
SynonymsIl18ralpha, Il1rrp
MMRRC Submission 042567-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4972 (G1)
Quality Score92
Status Validated
Chromosome1
Chromosomal Location40465552-40500854 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 40491064 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 317 (P317L)
Ref Sequence ENSEMBL: ENSMUSP00000141695 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087983] [ENSMUST00000108044] [ENSMUST00000167723] [ENSMUST00000193391] [ENSMUST00000193793] [ENSMUST00000195684]
Predicted Effect probably benign
Transcript: ENSMUST00000087983
AA Change: P317L

PolyPhen 2 Score 0.373 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000085298
Gene: ENSMUSG00000026070
AA Change: P317L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 25 113 8.93e-1 SMART
IG_like 126 204 7.06e0 SMART
IG 219 315 3.63e0 SMART
transmembrane domain 326 348 N/A INTRINSIC
TIR 371 519 3.8e-37 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108044
AA Change: P317L

PolyPhen 2 Score 0.373 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000103679
Gene: ENSMUSG00000026070
AA Change: P317L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 25 113 8.93e-1 SMART
IG_like 126 204 7.06e0 SMART
IG 219 315 3.63e0 SMART
transmembrane domain 326 348 N/A INTRINSIC
TIR 371 519 3.8e-37 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167723
AA Change: P317L

PolyPhen 2 Score 0.387 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000128277
Gene: ENSMUSG00000026070
AA Change: P317L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 25 113 8.93e-1 SMART
IG_like 126 204 7.06e0 SMART
IG 219 315 3.63e0 SMART
transmembrane domain 326 348 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193391
AA Change: P317L

PolyPhen 2 Score 0.387 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000141695
Gene: ENSMUSG00000026070
AA Change: P317L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 25 113 8.93e-1 SMART
IG_like 126 204 7.06e0 SMART
IG 219 315 3.63e0 SMART
transmembrane domain 326 348 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193793
SMART Domains Protein: ENSMUSP00000141464
Gene: ENSMUSG00000026070

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 25 113 3.7e-3 SMART
IG_like 132 189 9.7e-3 SMART
Pfam:Ig_2 214 263 5.2e-1 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195684
AA Change: P317L

PolyPhen 2 Score 0.373 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000142070
Gene: ENSMUSG00000026070
AA Change: P317L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 25 113 8.93e-1 SMART
IG_like 126 204 7.06e0 SMART
IG 219 315 3.63e0 SMART
transmembrane domain 326 348 N/A INTRINSIC
TIR 371 519 3.8e-37 SMART
Meta Mutation Damage Score 0.1264 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.2%
Validation Efficiency 93% (82/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytokine receptor that belongs to the interleukin 1 receptor family. This receptor specifically binds interleukin 18 (IL18), and is essential for IL18 mediated signal transduction. IFN-alpha and IL12 are reported to induce the expression of this receptor in NK and T cells. This gene along with four other members of the interleukin 1 receptor family, including IL1R2, IL1R1, ILRL2 (IL-1Rrp2), and IL1RL1 (T1/ST2), form a gene cluster on chromosome 2q. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for disruptions in this gene exhibit impaire Th1 cell development and defective NK cell physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A T 14: 32,661,404 I868N possibly damaging Het
A730013G03Rik C G 1: 192,833,773 noncoding transcript Het
Actl11 A G 9: 107,929,956 T493A probably benign Het
Actn1 T C 12: 80,173,039 D686G probably benign Het
Adamts1 G A 16: 85,795,945 T525I probably damaging Het
Adcy10 T A 1: 165,556,862 L1064H probably damaging Het
AI661453 A T 17: 47,466,399 probably benign Het
Apba1 T A 19: 23,912,536 S433T probably benign Het
Arid4b T A 13: 14,160,272 N355K probably benign Het
Bsn A T 9: 108,115,178 M1125K probably damaging Het
C2cd5 A T 6: 143,013,224 M1003K probably damaging Het
Ccdc18 A G 5: 108,192,003 M805V probably benign Het
Cep89 T G 7: 35,432,552 L637R probably damaging Het
Col24a1 A T 3: 145,509,684 I1444F probably benign Het
Commd4 A T 9: 57,155,448 S175T probably benign Het
Coq7 A G 7: 118,510,117 V236A unknown Het
Dctn2 C T 10: 127,276,703 R176C probably damaging Het
Ddx31 T C 2: 28,860,770 F389L probably damaging Het
Dgkz C T 2: 91,945,702 R72H probably benign Het
Dpysl4 A G 7: 139,090,290 D24G probably damaging Het
Dydc1 A G 14: 41,082,338 T106A probably benign Het
F13b A G 1: 139,510,923 Y355C probably damaging Het
Fcrl5 A G 3: 87,454,650 M407V probably benign Het
Fzd5 C A 1: 64,736,012 V197L probably benign Het
Galnt16 G T 12: 80,572,329 E70* probably null Het
Gm8979 T C 7: 106,083,314 noncoding transcript Het
Gpr171 A T 3: 59,097,965 F130I probably damaging Het
Grin3a T C 4: 49,770,484 N763D probably damaging Het
Gsta2 A T 9: 78,337,679 M51K probably damaging Het
Hacd3 A T 9: 64,990,436 I298N probably damaging Het
Iscu T A 5: 113,776,976 probably benign Het
Kif6 A G 17: 49,707,619 D250G probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lcn6 T A 2: 25,680,067 C82S probably damaging Het
Mob4 C G 1: 55,151,002 L135V possibly damaging Het
Mpzl3 T A 9: 45,062,256 probably benign Het
Mvp T C 7: 126,989,798 D599G probably damaging Het
Myo1a T C 10: 127,716,309 Y766H probably benign Het
Myo5b A G 18: 74,627,193 H260R probably damaging Het
Nbea C T 3: 56,085,246 R313H probably damaging Het
Necab1 T A 4: 14,978,216 D211V probably damaging Het
Nefl G T 14: 68,086,763 probably benign Het
Nfx1 T A 4: 40,976,375 D16E probably benign Het
Nlrp9a G T 7: 26,570,539 C797F probably damaging Het
Olfr1280 T A 2: 111,315,818 V113E probably damaging Het
Olfr467 A G 7: 107,814,746 Q56R probably benign Het
Pde6b A G 5: 108,425,264 D500G probably benign Het
Pgs1 T C 11: 118,005,893 probably null Het
Polr3b T A 10: 84,638,124 I189N probably damaging Het
Ppwd1 A T 13: 104,220,108 S300T probably benign Het
Prl2c2 A C 13: 13,002,170 N55K possibly damaging Het
Prpf19 C T 19: 10,899,345 probably benign Het
Prph2 G T 17: 46,910,807 L37F possibly damaging Het
Ptprg G T 14: 12,226,427 R565L possibly damaging Het
Rab8a C T 8: 72,171,275 T74M probably damaging Het
Rexo1 A T 10: 80,549,693 F510L probably damaging Het
Rexo2 G T 9: 48,479,389 T51K probably damaging Het
Sh3d21 T C 4: 126,152,416 K147R possibly damaging Het
Skint6 A G 4: 112,835,068 I1062T probably benign Het
Spag16 C T 1: 70,724,928 R636W probably damaging Het
Spata16 T C 3: 26,840,723 I307T possibly damaging Het
Speer4f2 T G 5: 17,374,425 I74S probably benign Het
Svep1 T A 4: 58,087,778 Y1767F possibly damaging Het
Swt1 T C 1: 151,423,542 S7G probably benign Het
Tex9 A G 9: 72,478,338 probably null Het
Thsd7b C A 1: 130,188,572 P1354H probably damaging Het
Ticrr A G 7: 79,669,668 D467G probably damaging Het
Tmco5b A C 2: 113,296,993 D303A probably damaging Het
Trpm7 A G 2: 126,824,058 V876A probably damaging Het
Ttc21a G A 9: 119,944,961 E245K probably benign Het
Vezt C T 10: 94,000,350 probably null Het
Zscan20 G A 4: 128,592,359 P183S probably benign Het
Other mutations in Il18r1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Il18r1 APN 1 40498652 missense possibly damaging 0.68
IGL00742:Il18r1 APN 1 40480991 missense probably benign 0.11
IGL01448:Il18r1 APN 1 40474730 missense probably damaging 1.00
IGL01726:Il18r1 APN 1 40498403 missense possibly damaging 0.83
IGL02081:Il18r1 APN 1 40498505 missense probably damaging 1.00
IGL02425:Il18r1 APN 1 40491221 splice site probably benign
IGL02447:Il18r1 APN 1 40498337 critical splice acceptor site probably null
IGL02529:Il18r1 APN 1 40487059 missense possibly damaging 0.77
IGL02863:Il18r1 APN 1 40487007 missense probably damaging 1.00
IGL02928:Il18r1 APN 1 40478551 critical splice donor site probably null
IGL02941:Il18r1 APN 1 40498551 missense probably damaging 0.99
IGL03156:Il18r1 APN 1 40498368 missense possibly damaging 0.92
R0532:Il18r1 UTSW 1 40474901 missense probably damaging 0.97
R0926:Il18r1 UTSW 1 40487028 missense probably damaging 1.00
R1909:Il18r1 UTSW 1 40474914 missense probably damaging 1.00
R2212:Il18r1 UTSW 1 40491067 missense probably damaging 1.00
R2254:Il18r1 UTSW 1 40491220 missense possibly damaging 0.91
R2860:Il18r1 UTSW 1 40498557 missense possibly damaging 0.49
R2861:Il18r1 UTSW 1 40498557 missense possibly damaging 0.49
R2862:Il18r1 UTSW 1 40498557 missense possibly damaging 0.49
R3412:Il18r1 UTSW 1 40491067 missense probably damaging 1.00
R3432:Il18r1 UTSW 1 40487089 missense probably damaging 0.99
R3718:Il18r1 UTSW 1 40495788 missense probably benign 0.00
R3816:Il18r1 UTSW 1 40486972 splice site probably benign
R3894:Il18r1 UTSW 1 40474874 missense possibly damaging 0.79
R4061:Il18r1 UTSW 1 40474936 missense probably benign 0.33
R4062:Il18r1 UTSW 1 40474936 missense probably benign 0.33
R4381:Il18r1 UTSW 1 40471790 missense probably benign 0.00
R5059:Il18r1 UTSW 1 40481067 critical splice donor site probably null
R6229:Il18r1 UTSW 1 40474763 missense probably benign 0.02
R6458:Il18r1 UTSW 1 40491182 nonsense probably null
R6505:Il18r1 UTSW 1 40489707 missense probably benign
R6738:Il18r1 UTSW 1 40498656 missense probably benign 0.06
R7002:Il18r1 UTSW 1 40474853 missense probably benign 0.39
R7317:Il18r1 UTSW 1 40474832 missense possibly damaging 0.80
X0023:Il18r1 UTSW 1 40471761 missense probably benign 0.04
X0064:Il18r1 UTSW 1 40495713 intron probably null
Z1088:Il18r1 UTSW 1 40474751 missense probably damaging 1.00
Z1088:Il18r1 UTSW 1 40478486 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTCCCACTGTAGACTACCAGC -3'
(R):5'- AAACATGAGCTAGGGTGCCC -3'

Sequencing Primer
(F):5'- CTGTAGACTACCAGCAGGAGTGTG -3'
(R):5'- CCTGTCACAGCAGCATATTACCTG -3'
Posted On2016-04-27