Incidental Mutation 'R4972:Dgkz'
ID384494
Institutional Source Beutler Lab
Gene Symbol Dgkz
Ensembl Gene ENSMUSG00000040479
Gene Namediacylglycerol kinase zeta
SynonymsE130307B02Rik, mDGK[z]
MMRRC Submission 042567-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4972 (G1)
Quality Score197
Status Validated
Chromosome2
Chromosomal Location91932824-91975864 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 91945702 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 72 (R72H)
Ref Sequence ENSEMBL: ENSMUSP00000106934 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028667] [ENSMUST00000099709] [ENSMUST00000111303] [ENSMUST00000128152] [ENSMUST00000142090] [ENSMUST00000142231] [ENSMUST00000178895]
Predicted Effect probably benign
Transcript: ENSMUST00000028667
SMART Domains Protein: ENSMUSP00000028667
Gene: ENSMUSG00000040479

DomainStartEndE-ValueType
low complexity region 3 30 N/A INTRINSIC
low complexity region 66 75 N/A INTRINSIC
C1 96 153 2.67e-1 SMART
C1 173 231 8.18e-7 SMART
low complexity region 257 274 N/A INTRINSIC
DAGKc 296 420 4.61e-65 SMART
DAGKa 447 604 2.75e-95 SMART
low complexity region 762 780 N/A INTRINSIC
ANK 823 853 8.52e-4 SMART
ANK 858 887 2.18e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000099709
SMART Domains Protein: ENSMUSP00000106937
Gene: ENSMUSG00000040479

DomainStartEndE-ValueType
low complexity region 2 38 N/A INTRINSIC
low complexity region 83 92 N/A INTRINSIC
C1 113 170 2.67e-1 SMART
C1 190 248 8.18e-7 SMART
low complexity region 274 291 N/A INTRINSIC
DAGKc 313 437 4.61e-65 SMART
DAGKa 464 621 2.75e-95 SMART
low complexity region 779 797 N/A INTRINSIC
ANK 840 870 8.52e-4 SMART
ANK 875 904 2.18e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111303
AA Change: R72H

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000106934
Gene: ENSMUSG00000040479
AA Change: R72H

DomainStartEndE-ValueType
low complexity region 39 58 N/A INTRINSIC
low complexity region 66 81 N/A INTRINSIC
low complexity region 100 113 N/A INTRINSIC
low complexity region 118 133 N/A INTRINSIC
low complexity region 200 214 N/A INTRINSIC
low complexity region 260 269 N/A INTRINSIC
C1 290 347 2.67e-1 SMART
C1 367 425 8.18e-7 SMART
low complexity region 451 468 N/A INTRINSIC
DAGKc 490 614 4.61e-65 SMART
DAGKa 641 798 2.75e-95 SMART
low complexity region 956 974 N/A INTRINSIC
ANK 1017 1047 8.52e-4 SMART
ANK 1052 1081 2.18e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126473
Predicted Effect probably benign
Transcript: ENSMUST00000128152
SMART Domains Protein: ENSMUSP00000118684
Gene: ENSMUSG00000040479

DomainStartEndE-ValueType
low complexity region 32 41 N/A INTRINSIC
Blast:C1 62 114 9e-33 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000142090
Predicted Effect probably benign
Transcript: ENSMUST00000142231
SMART Domains Protein: ENSMUSP00000114740
Gene: ENSMUSG00000040479

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178895
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183498
Meta Mutation Damage Score 0.438 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.2%
Validation Efficiency 93% (82/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the eukaryotic diacylglycerol kinase family. It may attenuate protein kinase C activity by regulating diacylglycerol levels in intracellular signaling cascade and signal transduction. Alternative splicing occurs at this locus and multiple transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Nov 2010]
PHENOTYPE: The T cell response is enhanced in homozygous mutant mice, which showed a robust response to viral infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A T 14: 32,661,404 I868N possibly damaging Het
A730013G03Rik C G 1: 192,833,773 noncoding transcript Het
Actl11 A G 9: 107,929,956 T493A probably benign Het
Actn1 T C 12: 80,173,039 D686G probably benign Het
Adamts1 G A 16: 85,795,945 T525I probably damaging Het
Adcy10 T A 1: 165,556,862 L1064H probably damaging Het
AI661453 A T 17: 47,466,399 probably benign Het
Apba1 T A 19: 23,912,536 S433T probably benign Het
Arid4b T A 13: 14,160,272 N355K probably benign Het
Bsn A T 9: 108,115,178 M1125K probably damaging Het
C2cd5 A T 6: 143,013,224 M1003K probably damaging Het
Ccdc18 A G 5: 108,192,003 M805V probably benign Het
Cep89 T G 7: 35,432,552 L637R probably damaging Het
Col24a1 A T 3: 145,509,684 I1444F probably benign Het
Commd4 A T 9: 57,155,448 S175T probably benign Het
Coq7 A G 7: 118,510,117 V236A unknown Het
Dctn2 C T 10: 127,276,703 R176C probably damaging Het
Ddx31 T C 2: 28,860,770 F389L probably damaging Het
Dpysl4 A G 7: 139,090,290 D24G probably damaging Het
Dydc1 A G 14: 41,082,338 T106A probably benign Het
F13b A G 1: 139,510,923 Y355C probably damaging Het
Fcrl5 A G 3: 87,454,650 M407V probably benign Het
Fzd5 C A 1: 64,736,012 V197L probably benign Het
Galnt16 G T 12: 80,572,329 E70* probably null Het
Gm8979 T C 7: 106,083,314 noncoding transcript Het
Gpr171 A T 3: 59,097,965 F130I probably damaging Het
Grin3a T C 4: 49,770,484 N763D probably damaging Het
Gsta2 A T 9: 78,337,679 M51K probably damaging Het
Hacd3 A T 9: 64,990,436 I298N probably damaging Het
Il18r1 C T 1: 40,491,064 P317L probably benign Het
Iscu T A 5: 113,776,976 probably benign Het
Kif6 A G 17: 49,707,619 D250G probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lcn6 T A 2: 25,680,067 C82S probably damaging Het
Mob4 C G 1: 55,151,002 L135V possibly damaging Het
Mpzl3 T A 9: 45,062,256 probably benign Het
Mvp T C 7: 126,989,798 D599G probably damaging Het
Myo1a T C 10: 127,716,309 Y766H probably benign Het
Myo5b A G 18: 74,627,193 H260R probably damaging Het
Nbea C T 3: 56,085,246 R313H probably damaging Het
Necab1 T A 4: 14,978,216 D211V probably damaging Het
Nefl G T 14: 68,086,763 probably benign Het
Nfx1 T A 4: 40,976,375 D16E probably benign Het
Nlrp9a G T 7: 26,570,539 C797F probably damaging Het
Olfr1280 T A 2: 111,315,818 V113E probably damaging Het
Olfr467 A G 7: 107,814,746 Q56R probably benign Het
Pde6b A G 5: 108,425,264 D500G probably benign Het
Pgs1 T C 11: 118,005,893 probably null Het
Polr3b T A 10: 84,638,124 I189N probably damaging Het
Ppwd1 A T 13: 104,220,108 S300T probably benign Het
Prl2c2 A C 13: 13,002,170 N55K possibly damaging Het
Prpf19 C T 19: 10,899,345 probably benign Het
Prph2 G T 17: 46,910,807 L37F possibly damaging Het
Ptprg G T 14: 12,226,427 R565L possibly damaging Het
Rab8a C T 8: 72,171,275 T74M probably damaging Het
Rexo1 A T 10: 80,549,693 F510L probably damaging Het
Rexo2 G T 9: 48,479,389 T51K probably damaging Het
Sh3d21 T C 4: 126,152,416 K147R possibly damaging Het
Skint6 A G 4: 112,835,068 I1062T probably benign Het
Spag16 C T 1: 70,724,928 R636W probably damaging Het
Spata16 T C 3: 26,840,723 I307T possibly damaging Het
Speer4f2 T G 5: 17,374,425 I74S probably benign Het
Svep1 T A 4: 58,087,778 Y1767F possibly damaging Het
Swt1 T C 1: 151,423,542 S7G probably benign Het
Tex9 A G 9: 72,478,338 probably null Het
Thsd7b C A 1: 130,188,572 P1354H probably damaging Het
Ticrr A G 7: 79,669,668 D467G probably damaging Het
Tmco5b A C 2: 113,296,993 D303A probably damaging Het
Trpm7 A G 2: 126,824,058 V876A probably damaging Het
Ttc21a G A 9: 119,944,961 E245K probably benign Het
Vezt C T 10: 94,000,350 probably null Het
Zscan20 G A 4: 128,592,359 P183S probably benign Het
Other mutations in Dgkz
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01680:Dgkz APN 2 91935865 missense probably benign 0.00
IGL01995:Dgkz APN 2 91934050 splice site probably benign
IGL02247:Dgkz APN 2 91937460 missense probably benign 0.00
IGL02573:Dgkz APN 2 91934197 missense probably damaging 0.98
IGL02627:Dgkz APN 2 91938710 splice site probably benign
IGL02903:Dgkz APN 2 91939962 missense possibly damaging 0.45
IGL03106:Dgkz APN 2 91940859 missense probably damaging 0.99
R0103:Dgkz UTSW 2 91934205 missense probably benign
R0312:Dgkz UTSW 2 91938339 missense probably damaging 1.00
R0761:Dgkz UTSW 2 91945351 missense probably benign 0.00
R0839:Dgkz UTSW 2 91935111 missense probably benign 0.00
R1162:Dgkz UTSW 2 91944444 missense probably damaging 1.00
R1223:Dgkz UTSW 2 91939315 splice site probably benign
R1539:Dgkz UTSW 2 91938060 missense probably damaging 1.00
R1934:Dgkz UTSW 2 91937104 missense possibly damaging 0.92
R1936:Dgkz UTSW 2 91937978 missense possibly damaging 0.94
R3438:Dgkz UTSW 2 91934050 splice site probably benign
R3804:Dgkz UTSW 2 91939630 missense probably benign 0.06
R4675:Dgkz UTSW 2 91938346 nonsense probably null
R4731:Dgkz UTSW 2 91938339 missense probably damaging 1.00
R4732:Dgkz UTSW 2 91938339 missense probably damaging 1.00
R4733:Dgkz UTSW 2 91938339 missense probably damaging 1.00
R4901:Dgkz UTSW 2 91936731 missense probably benign
R5027:Dgkz UTSW 2 91945543 missense probably benign 0.02
R5128:Dgkz UTSW 2 91942683 missense probably damaging 1.00
R5408:Dgkz UTSW 2 91935823 missense possibly damaging 0.91
R5494:Dgkz UTSW 2 91941049 splice site probably null
R5728:Dgkz UTSW 2 91945787 missense possibly damaging 0.93
R5813:Dgkz UTSW 2 91939388 missense possibly damaging 0.50
R6025:Dgkz UTSW 2 91945910 missense possibly damaging 0.75
R6043:Dgkz UTSW 2 91935889 missense probably benign 0.03
R6328:Dgkz UTSW 2 91942635 missense probably benign 0.04
R6335:Dgkz UTSW 2 91944379 missense probably benign 0.16
X0002:Dgkz UTSW 2 91936562 missense probably damaging 0.97
X0021:Dgkz UTSW 2 91937119 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- ACCTGGCCTAGCATCACTTG -3'
(R):5'- TTTCCAACGAAAGGCACGAG -3'

Sequencing Primer
(F):5'- AGCATCACTTGTCGCCTCAG -3'
(R):5'- ACGAAAGGCACGAGGTCCC -3'
Posted On2016-04-27