Incidental Mutation 'R4972:Sh3d21'
ID384508
Institutional Source Beutler Lab
Gene Symbol Sh3d21
Ensembl Gene ENSMUSG00000073758
Gene NameSH3 domain containing 21
Synonyms
MMRRC Submission 042567-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R4972 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location126150602-126163491 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 126152416 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 147 (K147R)
Ref Sequence ENSEMBL: ENSMUSP00000092352 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052876] [ENSMUST00000094760] [ENSMUST00000097891] [ENSMUST00000106150] [ENSMUST00000106152]
Predicted Effect probably benign
Transcript: ENSMUST00000052876
SMART Domains Protein: ENSMUSP00000054141
Gene: ENSMUSG00000050212

DomainStartEndE-ValueType
Pfam:FAM176 7 154 5.3e-59 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000094760
AA Change: K147R

PolyPhen 2 Score 0.645 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000092352
Gene: ENSMUSG00000073758
AA Change: K147R

DomainStartEndE-ValueType
SH3 68 125 7.11e-22 SMART
low complexity region 211 221 N/A INTRINSIC
low complexity region 464 473 N/A INTRINSIC
coiled coil region 482 510 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097891
AA Change: K263R

PolyPhen 2 Score 0.136 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000095501
Gene: ENSMUSG00000073758
AA Change: K263R

DomainStartEndE-ValueType
SH3 1 57 4.29e-7 SMART
low complexity region 66 76 N/A INTRINSIC
SH3 86 141 2.96e-19 SMART
SH3 184 241 7.11e-22 SMART
low complexity region 327 337 N/A INTRINSIC
low complexity region 580 589 N/A INTRINSIC
coiled coil region 598 626 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106150
SMART Domains Protein: ENSMUSP00000101756
Gene: ENSMUSG00000050212

DomainStartEndE-ValueType
Pfam:FAM176 7 154 3e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106152
SMART Domains Protein: ENSMUSP00000101758
Gene: ENSMUSG00000050212

DomainStartEndE-ValueType
Pfam:FAM176 7 154 3e-63 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122969
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141638
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142891
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152402
Meta Mutation Damage Score 0.216 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.2%
Validation Efficiency 93% (82/88)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A T 14: 32,661,404 I868N possibly damaging Het
A730013G03Rik C G 1: 192,833,773 noncoding transcript Het
Actl11 A G 9: 107,929,956 T493A probably benign Het
Actn1 T C 12: 80,173,039 D686G probably benign Het
Adamts1 G A 16: 85,795,945 T525I probably damaging Het
Adcy10 T A 1: 165,556,862 L1064H probably damaging Het
AI661453 A T 17: 47,466,399 probably benign Het
Apba1 T A 19: 23,912,536 S433T probably benign Het
Arid4b T A 13: 14,160,272 N355K probably benign Het
Bsn A T 9: 108,115,178 M1125K probably damaging Het
C2cd5 A T 6: 143,013,224 M1003K probably damaging Het
Ccdc18 A G 5: 108,192,003 M805V probably benign Het
Cep89 T G 7: 35,432,552 L637R probably damaging Het
Col24a1 A T 3: 145,509,684 I1444F probably benign Het
Commd4 A T 9: 57,155,448 S175T probably benign Het
Coq7 A G 7: 118,510,117 V236A unknown Het
Dctn2 C T 10: 127,276,703 R176C probably damaging Het
Ddx31 T C 2: 28,860,770 F389L probably damaging Het
Dgkz C T 2: 91,945,702 R72H probably benign Het
Dpysl4 A G 7: 139,090,290 D24G probably damaging Het
Dydc1 A G 14: 41,082,338 T106A probably benign Het
F13b A G 1: 139,510,923 Y355C probably damaging Het
Fcrl5 A G 3: 87,454,650 M407V probably benign Het
Fzd5 C A 1: 64,736,012 V197L probably benign Het
Galnt16 G T 12: 80,572,329 E70* probably null Het
Gm8979 T C 7: 106,083,314 noncoding transcript Het
Gpr171 A T 3: 59,097,965 F130I probably damaging Het
Grin3a T C 4: 49,770,484 N763D probably damaging Het
Gsta2 A T 9: 78,337,679 M51K probably damaging Het
Hacd3 A T 9: 64,990,436 I298N probably damaging Het
Il18r1 C T 1: 40,491,064 P317L probably benign Het
Iscu T A 5: 113,776,976 probably benign Het
Kif6 A G 17: 49,707,619 D250G probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lcn6 T A 2: 25,680,067 C82S probably damaging Het
Mob4 C G 1: 55,151,002 L135V possibly damaging Het
Mpzl3 T A 9: 45,062,256 probably benign Het
Mvp T C 7: 126,989,798 D599G probably damaging Het
Myo1a T C 10: 127,716,309 Y766H probably benign Het
Myo5b A G 18: 74,627,193 H260R probably damaging Het
Nbea C T 3: 56,085,246 R313H probably damaging Het
Necab1 T A 4: 14,978,216 D211V probably damaging Het
Nefl G T 14: 68,086,763 probably benign Het
Nfx1 T A 4: 40,976,375 D16E probably benign Het
Nlrp9a G T 7: 26,570,539 C797F probably damaging Het
Olfr1280 T A 2: 111,315,818 V113E probably damaging Het
Olfr467 A G 7: 107,814,746 Q56R probably benign Het
Pde6b A G 5: 108,425,264 D500G probably benign Het
Pgs1 T C 11: 118,005,893 probably null Het
Polr3b T A 10: 84,638,124 I189N probably damaging Het
Ppwd1 A T 13: 104,220,108 S300T probably benign Het
Prl2c2 A C 13: 13,002,170 N55K possibly damaging Het
Prpf19 C T 19: 10,899,345 probably benign Het
Prph2 G T 17: 46,910,807 L37F possibly damaging Het
Ptprg G T 14: 12,226,427 R565L possibly damaging Het
Rab8a C T 8: 72,171,275 T74M probably damaging Het
Rexo1 A T 10: 80,549,693 F510L probably damaging Het
Rexo2 G T 9: 48,479,389 T51K probably damaging Het
Skint6 A G 4: 112,835,068 I1062T probably benign Het
Spag16 C T 1: 70,724,928 R636W probably damaging Het
Spata16 T C 3: 26,840,723 I307T possibly damaging Het
Speer4f2 T G 5: 17,374,425 I74S probably benign Het
Svep1 T A 4: 58,087,778 Y1767F possibly damaging Het
Swt1 T C 1: 151,423,542 S7G probably benign Het
Tex9 A G 9: 72,478,338 probably null Het
Thsd7b C A 1: 130,188,572 P1354H probably damaging Het
Ticrr A G 7: 79,669,668 D467G probably damaging Het
Tmco5b A C 2: 113,296,993 D303A probably damaging Het
Trpm7 A G 2: 126,824,058 V876A probably damaging Het
Ttc21a G A 9: 119,944,961 E245K probably benign Het
Vezt C T 10: 94,000,350 probably null Het
Zscan20 G A 4: 128,592,359 P183S probably benign Het
Other mutations in Sh3d21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02172:Sh3d21 APN 4 126152360 missense probably benign
IGL02869:Sh3d21 APN 4 126162241 missense probably benign 0.23
R0827:Sh3d21 UTSW 4 126152271 unclassified probably benign
R0834:Sh3d21 UTSW 4 126151272 missense probably benign 0.02
R0890:Sh3d21 UTSW 4 126151152 missense probably damaging 1.00
R1519:Sh3d21 UTSW 4 126151726 nonsense probably null
R1864:Sh3d21 UTSW 4 126150936 critical splice acceptor site probably null
R1986:Sh3d21 UTSW 4 126162497 missense probably damaging 1.00
R3429:Sh3d21 UTSW 4 126162832 missense probably benign 0.25
R3430:Sh3d21 UTSW 4 126162832 missense probably benign 0.25
R4244:Sh3d21 UTSW 4 126150718 unclassified probably benign
R4501:Sh3d21 UTSW 4 126162859 frame shift probably null
R5117:Sh3d21 UTSW 4 126151872 missense probably damaging 1.00
R5249:Sh3d21 UTSW 4 126162065 unclassified probably benign
R5293:Sh3d21 UTSW 4 126152257 missense probably benign 0.18
R5556:Sh3d21 UTSW 4 126162236 missense possibly damaging 0.50
R7085:Sh3d21 UTSW 4 126163091 missense probably benign 0.02
R7247:Sh3d21 UTSW 4 126152115 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTGAAAGTGTCCTGGAACACAC -3'
(R):5'- CATCGAATCAAAGCCTGTCAG -3'

Sequencing Primer
(F):5'- CACACGAGCAACTTGTGAGTCG -3'
(R):5'- AAGCCTGTCAGGAGAGTGCTC -3'
Posted On2016-04-27