Incidental Mutation 'R4972:Bsn'
ID384535
Institutional Source Beutler Lab
Gene Symbol Bsn
Ensembl Gene ENSMUSG00000032589
Gene Namebassoon
Synonymspresynaptic cytomatrix protein
MMRRC Submission 042567-MU
Accession Numbers

Genbank: NM_007567; MGI: 1277955

Is this an essential gene? Possibly non essential (E-score: 0.340) question?
Stock #R4972 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location108096022-108190384 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 108115178 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1125 (M1125K)
Ref Sequence ENSEMBL: ENSMUSP00000035208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035208]
Predicted Effect probably damaging
Transcript: ENSMUST00000035208
AA Change: M1125K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000035208
Gene: ENSMUSG00000032589
AA Change: M1125K

DomainStartEndE-ValueType
low complexity region 4 40 N/A INTRINSIC
low complexity region 42 77 N/A INTRINSIC
Pfam:zf-piccolo 165 223 6.1e-30 PFAM
low complexity region 394 409 N/A INTRINSIC
low complexity region 445 454 N/A INTRINSIC
Pfam:zf-piccolo 462 520 5.2e-31 PFAM
low complexity region 527 540 N/A INTRINSIC
low complexity region 627 643 N/A INTRINSIC
low complexity region 664 681 N/A INTRINSIC
low complexity region 694 708 N/A INTRINSIC
low complexity region 788 803 N/A INTRINSIC
low complexity region 994 1021 N/A INTRINSIC
coiled coil region 1047 1101 N/A INTRINSIC
low complexity region 1131 1145 N/A INTRINSIC
low complexity region 1173 1190 N/A INTRINSIC
low complexity region 1209 1220 N/A INTRINSIC
low complexity region 1333 1343 N/A INTRINSIC
low complexity region 1443 1455 N/A INTRINSIC
low complexity region 1481 1498 N/A INTRINSIC
low complexity region 1790 1800 N/A INTRINSIC
low complexity region 2117 2126 N/A INTRINSIC
low complexity region 2287 2303 N/A INTRINSIC
low complexity region 2326 2356 N/A INTRINSIC
SCOP:d1eq1a_ 2362 2477 2e-7 SMART
low complexity region 2607 2614 N/A INTRINSIC
low complexity region 2635 2651 N/A INTRINSIC
low complexity region 2655 2672 N/A INTRINSIC
coiled coil region 2949 2990 N/A INTRINSIC
low complexity region 3057 3071 N/A INTRINSIC
low complexity region 3089 3114 N/A INTRINSIC
low complexity region 3446 3461 N/A INTRINSIC
low complexity region 3520 3534 N/A INTRINSIC
low complexity region 3653 3666 N/A INTRINSIC
low complexity region 3750 3820 N/A INTRINSIC
low complexity region 3831 3852 N/A INTRINSIC
low complexity region 3856 3901 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124763
Meta Mutation Damage Score 0.112 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.2%
Validation Efficiency 93% (82/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Neurotransmitters are released from a specific site in the axon terminal called the active zone, which is composed of synaptic vesicles and a meshwork of cytoskeleton underlying the plasma membrane. The protein encoded by this gene is thought to be a scaffolding protein involved in organizing the presynaptic cytoskeleton. The gene is expressed primarily in neurons in the brain. A similar gene product in rodents is concentrated in the active zone of axon terminals and tightly associated with cytoskeletal structures, and is essential for regulating neurotransmitter release from a subset of synapses. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutants lacking functional protein exhibit impaired hippocampal and photoreceptor synaptic transmission, aberrant photoreceptor ribbon synapse formation, and spontaneous epileptic seizures. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted, other(1) Gene trapped(8)

Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A T 14: 32,661,404 I868N possibly damaging Het
A730013G03Rik C G 1: 192,833,773 noncoding transcript Het
Actl11 A G 9: 107,929,956 T493A probably benign Het
Actn1 T C 12: 80,173,039 D686G probably benign Het
Adamts1 G A 16: 85,795,945 T525I probably damaging Het
Adcy10 T A 1: 165,556,862 L1064H probably damaging Het
AI661453 A T 17: 47,466,399 probably benign Het
Apba1 T A 19: 23,912,536 S433T probably benign Het
Arid4b T A 13: 14,160,272 N355K probably benign Het
C2cd5 A T 6: 143,013,224 M1003K probably damaging Het
Ccdc18 A G 5: 108,192,003 M805V probably benign Het
Cep89 T G 7: 35,432,552 L637R probably damaging Het
Col24a1 A T 3: 145,509,684 I1444F probably benign Het
Commd4 A T 9: 57,155,448 S175T probably benign Het
Coq7 A G 7: 118,510,117 V236A unknown Het
Dctn2 C T 10: 127,276,703 R176C probably damaging Het
Ddx31 T C 2: 28,860,770 F389L probably damaging Het
Dgkz C T 2: 91,945,702 R72H probably benign Het
Dpysl4 A G 7: 139,090,290 D24G probably damaging Het
Dydc1 A G 14: 41,082,338 T106A probably benign Het
F13b A G 1: 139,510,923 Y355C probably damaging Het
Fcrl5 A G 3: 87,454,650 M407V probably benign Het
Fzd5 C A 1: 64,736,012 V197L probably benign Het
Galnt16 G T 12: 80,572,329 E70* probably null Het
Gm8979 T C 7: 106,083,314 noncoding transcript Het
Gpr171 A T 3: 59,097,965 F130I probably damaging Het
Grin3a T C 4: 49,770,484 N763D probably damaging Het
Gsta2 A T 9: 78,337,679 M51K probably damaging Het
Hacd3 A T 9: 64,990,436 I298N probably damaging Het
Il18r1 C T 1: 40,491,064 P317L probably benign Het
Iscu T A 5: 113,776,976 probably benign Het
Kif6 A G 17: 49,707,619 D250G probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lcn6 T A 2: 25,680,067 C82S probably damaging Het
Mob4 C G 1: 55,151,002 L135V possibly damaging Het
Mpzl3 T A 9: 45,062,256 probably benign Het
Mvp T C 7: 126,989,798 D599G probably damaging Het
Myo1a T C 10: 127,716,309 Y766H probably benign Het
Myo5b A G 18: 74,627,193 H260R probably damaging Het
Nbea C T 3: 56,085,246 R313H probably damaging Het
Necab1 T A 4: 14,978,216 D211V probably damaging Het
Nefl G T 14: 68,086,763 probably benign Het
Nfx1 T A 4: 40,976,375 D16E probably benign Het
Nlrp9a G T 7: 26,570,539 C797F probably damaging Het
Olfr1280 T A 2: 111,315,818 V113E probably damaging Het
Olfr467 A G 7: 107,814,746 Q56R probably benign Het
Pde6b A G 5: 108,425,264 D500G probably benign Het
Pgs1 T C 11: 118,005,893 probably null Het
Polr3b T A 10: 84,638,124 I189N probably damaging Het
Ppwd1 A T 13: 104,220,108 S300T probably benign Het
Prl2c2 A C 13: 13,002,170 N55K possibly damaging Het
Prpf19 C T 19: 10,899,345 probably benign Het
Prph2 G T 17: 46,910,807 L37F possibly damaging Het
Ptprg G T 14: 12,226,427 R565L possibly damaging Het
Rab8a C T 8: 72,171,275 T74M probably damaging Het
Rexo1 A T 10: 80,549,693 F510L probably damaging Het
Rexo2 G T 9: 48,479,389 T51K probably damaging Het
Sh3d21 T C 4: 126,152,416 K147R possibly damaging Het
Skint6 A G 4: 112,835,068 I1062T probably benign Het
Spag16 C T 1: 70,724,928 R636W probably damaging Het
Spata16 T C 3: 26,840,723 I307T possibly damaging Het
Speer4f2 T G 5: 17,374,425 I74S probably benign Het
Svep1 T A 4: 58,087,778 Y1767F possibly damaging Het
Swt1 T C 1: 151,423,542 S7G probably benign Het
Tex9 A G 9: 72,478,338 probably null Het
Thsd7b C A 1: 130,188,572 P1354H probably damaging Het
Ticrr A G 7: 79,669,668 D467G probably damaging Het
Tmco5b A C 2: 113,296,993 D303A probably damaging Het
Trpm7 A G 2: 126,824,058 V876A probably damaging Het
Ttc21a G A 9: 119,944,961 E245K probably benign Het
Vezt C T 10: 94,000,350 probably null Het
Zscan20 G A 4: 128,592,359 P183S probably benign Het
Other mutations in Bsn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Bsn APN 9 108115110 missense probably benign 0.01
IGL00330:Bsn APN 9 108115340 missense probably damaging 1.00
IGL00863:Bsn APN 9 108115322 missense probably damaging 1.00
IGL01123:Bsn APN 9 108115986 missense probably damaging 1.00
IGL01330:Bsn APN 9 108110913 unclassified probably benign
IGL01336:Bsn APN 9 108111785 missense probably damaging 0.99
IGL01399:Bsn APN 9 108107187 missense unknown
IGL01683:Bsn APN 9 108114896 missense possibly damaging 0.71
IGL02022:Bsn APN 9 108110418 unclassified probably benign
IGL02396:Bsn APN 9 108116046 missense possibly damaging 0.90
IGL02538:Bsn APN 9 108105236 missense unknown
IGL02565:Bsn APN 9 108113288 missense probably damaging 0.99
IGL02661:Bsn APN 9 108106936 nonsense probably null
IGL02739:Bsn APN 9 108112546 missense probably benign 0.14
IGL02951:Bsn APN 9 108115613 missense probably damaging 1.00
IGL02987:Bsn APN 9 108126304 missense probably benign 0.03
IGL03033:Bsn APN 9 108115993 missense probably damaging 1.00
IGL03069:Bsn APN 9 108114263 missense probably damaging 1.00
IGL03076:Bsn APN 9 108105382 missense unknown
R0068:Bsn UTSW 9 108112137 missense probably damaging 1.00
R0068:Bsn UTSW 9 108112137 missense probably damaging 1.00
R0167:Bsn UTSW 9 108125986 missense probably benign 0.01
R0234:Bsn UTSW 9 108116396 missense possibly damaging 0.50
R0234:Bsn UTSW 9 108116396 missense possibly damaging 0.50
R0359:Bsn UTSW 9 108111846 missense possibly damaging 0.81
R0514:Bsn UTSW 9 108125782 missense probably benign 0.07
R0593:Bsn UTSW 9 108110306 missense unknown
R0617:Bsn UTSW 9 108107240 missense unknown
R0636:Bsn UTSW 9 108107834 missense unknown
R0652:Bsn UTSW 9 108105742 missense unknown
R0718:Bsn UTSW 9 108111360 unclassified probably benign
R0730:Bsn UTSW 9 108106812 missense unknown
R0905:Bsn UTSW 9 108105635 missense unknown
R0963:Bsn UTSW 9 108111807 missense possibly damaging 0.81
R0992:Bsn UTSW 9 108114354 nonsense probably null
R1101:Bsn UTSW 9 108116411 missense probably damaging 1.00
R1393:Bsn UTSW 9 108110517 unclassified probably benign
R1490:Bsn UTSW 9 108113994 missense probably benign 0.03
R1566:Bsn UTSW 9 108125985 missense probably benign 0.35
R1582:Bsn UTSW 9 108105092 missense unknown
R1738:Bsn UTSW 9 108106934 missense unknown
R1867:Bsn UTSW 9 108106719 missense unknown
R1918:Bsn UTSW 9 108107573 missense unknown
R1933:Bsn UTSW 9 108116444 missense possibly damaging 0.91
R1946:Bsn UTSW 9 108114651 missense probably damaging 0.99
R1978:Bsn UTSW 9 108114549 missense probably benign 0.35
R2068:Bsn UTSW 9 108110684 unclassified probably benign
R2068:Bsn UTSW 9 108126550 missense possibly damaging 0.95
R2113:Bsn UTSW 9 108114886 missense probably benign 0.14
R2136:Bsn UTSW 9 108113231 missense probably damaging 1.00
R2172:Bsn UTSW 9 108109992 intron probably benign
R2266:Bsn UTSW 9 108115124 missense probably damaging 1.00
R2293:Bsn UTSW 9 108113067 missense possibly damaging 0.47
R2294:Bsn UTSW 9 108113067 missense possibly damaging 0.47
R2368:Bsn UTSW 9 108111030 nonsense probably null
R2442:Bsn UTSW 9 108106920 missense unknown
R2507:Bsn UTSW 9 108116114 missense probably damaging 1.00
R2880:Bsn UTSW 9 108113067 missense possibly damaging 0.47
R2881:Bsn UTSW 9 108113067 missense possibly damaging 0.47
R2922:Bsn UTSW 9 108108186 missense unknown
R2922:Bsn UTSW 9 108115469 missense probably damaging 1.00
R3618:Bsn UTSW 9 108117561 critical splice acceptor site probably null
R3742:Bsn UTSW 9 108105739 missense unknown
R3825:Bsn UTSW 9 108106856 missense unknown
R3982:Bsn UTSW 9 108107166 missense unknown
R4094:Bsn UTSW 9 108113870 missense probably damaging 1.00
R4158:Bsn UTSW 9 108112946 missense possibly damaging 0.95
R4225:Bsn UTSW 9 108106733 missense unknown
R4261:Bsn UTSW 9 108110684 unclassified probably benign
R4482:Bsn UTSW 9 108114664 missense probably damaging 1.00
R4515:Bsn UTSW 9 108104078 splice site probably null
R4585:Bsn UTSW 9 108110463 unclassified probably benign
R4628:Bsn UTSW 9 108113235 missense probably damaging 1.00
R4636:Bsn UTSW 9 108115424 missense probably damaging 1.00
R4679:Bsn UTSW 9 108110130 missense unknown
R4723:Bsn UTSW 9 108112655 missense probably benign 0.03
R4843:Bsn UTSW 9 108107189 missense unknown
R4885:Bsn UTSW 9 108107527 nonsense probably null
R4936:Bsn UTSW 9 108111761 missense probably damaging 1.00
R4942:Bsn UTSW 9 108106479 missense unknown
R4992:Bsn UTSW 9 108115548 missense probably damaging 1.00
R5067:Bsn UTSW 9 108111953 missense probably damaging 1.00
R5206:Bsn UTSW 9 108105373 missense unknown
R5286:Bsn UTSW 9 108110924 unclassified probably benign
R5492:Bsn UTSW 9 108112515 missense probably damaging 0.98
R5553:Bsn UTSW 9 108110421 unclassified probably benign
R5561:Bsn UTSW 9 108105511 missense unknown
R5597:Bsn UTSW 9 108114932 missense probably benign 0.06
R5646:Bsn UTSW 9 108110432 unclassified probably benign
R5796:Bsn UTSW 9 108126024 missense probably damaging 1.00
R5801:Bsn UTSW 9 108113009 missense possibly damaging 0.81
R5802:Bsn UTSW 9 108113009 missense possibly damaging 0.81
R5850:Bsn UTSW 9 108114950 missense probably damaging 0.99
R5938:Bsn UTSW 9 108113009 missense possibly damaging 0.81
R6221:Bsn UTSW 9 108105566 missense unknown
R6243:Bsn UTSW 9 108107561 missense unknown
R6254:Bsn UTSW 9 108111866 missense probably damaging 0.96
R6263:Bsn UTSW 9 108113254 missense probably damaging 1.00
R6345:Bsn UTSW 9 108107355 missense unknown
R6368:Bsn UTSW 9 108111314 unclassified probably benign
R6574:Bsn UTSW 9 108113954 missense possibly damaging 0.95
R6793:Bsn UTSW 9 108114615 nonsense probably null
R6802:Bsn UTSW 9 108110624 unclassified probably benign
R6943:Bsn UTSW 9 108107817 missense unknown
R6999:Bsn UTSW 9 108113433 missense probably benign 0.00
R7149:Bsn UTSW 9 108116321 nonsense probably null
R7199:Bsn UTSW 9 108115334 missense probably damaging 1.00
R7322:Bsn UTSW 9 108126421 nonsense probably null
R7349:Bsn UTSW 9 108110783 missense unknown
R7372:Bsn UTSW 9 108110519 missense unknown
R7373:Bsn UTSW 9 108113484 missense probably damaging 1.00
X0028:Bsn UTSW 9 108113504 missense probably damaging 1.00
X0066:Bsn UTSW 9 108139210 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCATGTCCTCGTAGGCCTC -3'
(R):5'- TGTCTTCACTGGAGGAGGACAG -3'

Sequencing Primer
(F):5'- TCTTAAGGGGCCGTCCAGAAC -3'
(R):5'- TGCCCACCATCGAGGACTC -3'
Posted On2016-04-27