Incidental Mutation 'R4972:AI661453'
ID384554
Institutional Source Beutler Lab
Gene Symbol AI661453
Ensembl Gene ENSMUSG00000034382
Gene Nameexpressed sequence AI661453
Synonyms
MMRRC Submission 042567-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.043) question?
Stock #R4972 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location47436615-47470638 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to T at 47466399 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000045345 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037701] [ENSMUST00000150819]
Predicted Effect probably benign
Transcript: ENSMUST00000037701
SMART Domains Protein: ENSMUSP00000045345
Gene: ENSMUSG00000034382

DomainStartEndE-ValueType
low complexity region 140 151 N/A INTRINSIC
low complexity region 157 180 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000150819
AA Change: D350V
SMART Domains Protein: ENSMUSP00000120133
Gene: ENSMUSG00000034382
AA Change: D350V

DomainStartEndE-ValueType
low complexity region 140 151 N/A INTRINSIC
low complexity region 157 237 N/A INTRINSIC
low complexity region 294 312 N/A INTRINSIC
low complexity region 314 325 N/A INTRINSIC
low complexity region 354 364 N/A INTRINSIC
low complexity region 384 423 N/A INTRINSIC
low complexity region 429 444 N/A INTRINSIC
low complexity region 522 535 N/A INTRINSIC
low complexity region 612 627 N/A INTRINSIC
internal_repeat_1 628 654 6.24e-9 PROSPERO
low complexity region 656 671 N/A INTRINSIC
internal_repeat_1 688 714 6.24e-9 PROSPERO
low complexity region 853 863 N/A INTRINSIC
low complexity region 976 1016 N/A INTRINSIC
low complexity region 1147 1154 N/A INTRINSIC
Meta Mutation Damage Score 0.092 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.2%
Validation Efficiency 93% (82/88)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A T 14: 32,661,404 I868N possibly damaging Het
A730013G03Rik C G 1: 192,833,773 noncoding transcript Het
Actl11 A G 9: 107,929,956 T493A probably benign Het
Actn1 T C 12: 80,173,039 D686G probably benign Het
Adamts1 G A 16: 85,795,945 T525I probably damaging Het
Adcy10 T A 1: 165,556,862 L1064H probably damaging Het
Apba1 T A 19: 23,912,536 S433T probably benign Het
Arid4b T A 13: 14,160,272 N355K probably benign Het
Bsn A T 9: 108,115,178 M1125K probably damaging Het
C2cd5 A T 6: 143,013,224 M1003K probably damaging Het
Ccdc18 A G 5: 108,192,003 M805V probably benign Het
Cep89 T G 7: 35,432,552 L637R probably damaging Het
Col24a1 A T 3: 145,509,684 I1444F probably benign Het
Commd4 A T 9: 57,155,448 S175T probably benign Het
Coq7 A G 7: 118,510,117 V236A unknown Het
Dctn2 C T 10: 127,276,703 R176C probably damaging Het
Ddx31 T C 2: 28,860,770 F389L probably damaging Het
Dgkz C T 2: 91,945,702 R72H probably benign Het
Dpysl4 A G 7: 139,090,290 D24G probably damaging Het
Dydc1 A G 14: 41,082,338 T106A probably benign Het
F13b A G 1: 139,510,923 Y355C probably damaging Het
Fcrl5 A G 3: 87,454,650 M407V probably benign Het
Fzd5 C A 1: 64,736,012 V197L probably benign Het
Galnt16 G T 12: 80,572,329 E70* probably null Het
Gm8979 T C 7: 106,083,314 noncoding transcript Het
Gpr171 A T 3: 59,097,965 F130I probably damaging Het
Grin3a T C 4: 49,770,484 N763D probably damaging Het
Gsta2 A T 9: 78,337,679 M51K probably damaging Het
Hacd3 A T 9: 64,990,436 I298N probably damaging Het
Il18r1 C T 1: 40,491,064 P317L probably benign Het
Iscu T A 5: 113,776,976 probably benign Het
Kif6 A G 17: 49,707,619 D250G probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lcn6 T A 2: 25,680,067 C82S probably damaging Het
Mob4 C G 1: 55,151,002 L135V possibly damaging Het
Mpzl3 T A 9: 45,062,256 probably benign Het
Mvp T C 7: 126,989,798 D599G probably damaging Het
Myo1a T C 10: 127,716,309 Y766H probably benign Het
Myo5b A G 18: 74,627,193 H260R probably damaging Het
Nbea C T 3: 56,085,246 R313H probably damaging Het
Necab1 T A 4: 14,978,216 D211V probably damaging Het
Nefl G T 14: 68,086,763 probably benign Het
Nfx1 T A 4: 40,976,375 D16E probably benign Het
Nlrp9a G T 7: 26,570,539 C797F probably damaging Het
Olfr1280 T A 2: 111,315,818 V113E probably damaging Het
Olfr467 A G 7: 107,814,746 Q56R probably benign Het
Pde6b A G 5: 108,425,264 D500G probably benign Het
Pgs1 T C 11: 118,005,893 probably null Het
Polr3b T A 10: 84,638,124 I189N probably damaging Het
Ppwd1 A T 13: 104,220,108 S300T probably benign Het
Prl2c2 A C 13: 13,002,170 N55K possibly damaging Het
Prpf19 C T 19: 10,899,345 probably benign Het
Prph2 G T 17: 46,910,807 L37F possibly damaging Het
Ptprg G T 14: 12,226,427 R565L possibly damaging Het
Rab8a C T 8: 72,171,275 T74M probably damaging Het
Rexo1 A T 10: 80,549,693 F510L probably damaging Het
Rexo2 G T 9: 48,479,389 T51K probably damaging Het
Sh3d21 T C 4: 126,152,416 K147R possibly damaging Het
Skint6 A G 4: 112,835,068 I1062T probably benign Het
Spag16 C T 1: 70,724,928 R636W probably damaging Het
Spata16 T C 3: 26,840,723 I307T possibly damaging Het
Speer4f2 T G 5: 17,374,425 I74S probably benign Het
Svep1 T A 4: 58,087,778 Y1767F possibly damaging Het
Swt1 T C 1: 151,423,542 S7G probably benign Het
Tex9 A G 9: 72,478,338 probably null Het
Thsd7b C A 1: 130,188,572 P1354H probably damaging Het
Ticrr A G 7: 79,669,668 D467G probably damaging Het
Tmco5b A C 2: 113,296,993 D303A probably damaging Het
Trpm7 A G 2: 126,824,058 V876A probably damaging Het
Ttc21a G A 9: 119,944,961 E245K probably benign Het
Vezt C T 10: 94,000,350 probably null Het
Zscan20 G A 4: 128,592,359 P183S probably benign Het
Other mutations in AI661453
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01758:AI661453 APN 17 47466623 intron probably benign
IGL01995:AI661453 APN 17 47468517 intron probably benign
IGL02171:AI661453 APN 17 47466996 intron probably benign
IGL02411:AI661453 APN 17 47467338 intron probably benign
IGL02422:AI661453 APN 17 47467092 intron probably benign
IGL02609:AI661453 APN 17 47468372 intron probably benign
IGL02888:AI661453 APN 17 47467404 intron probably benign
IGL03024:AI661453 APN 17 47446588 missense probably damaging 1.00
R0077:AI661453 UTSW 17 47469362 intron probably benign
R0092:AI661453 UTSW 17 47467515 intron probably benign
R0144:AI661453 UTSW 17 47469299 intron probably benign
R0330:AI661453 UTSW 17 47446646 missense probably damaging 1.00
R0590:AI661453 UTSW 17 47467074 intron probably benign
R0839:AI661453 UTSW 17 47436827 missense probably null 0.97
R1350:AI661453 UTSW 17 47467928 nonsense probably null
R1436:AI661453 UTSW 17 47466702 intron probably benign
R1439:AI661453 UTSW 17 47466662 intron probably benign
R1643:AI661453 UTSW 17 47467866 intron probably benign
R1994:AI661453 UTSW 17 47467034 intron probably benign
R2145:AI661453 UTSW 17 47466098 intron probably benign
R2986:AI661453 UTSW 17 47466772 nonsense probably null
R4398:AI661453 UTSW 17 47468117 intron probably benign
R4809:AI661453 UTSW 17 47467187 intron probably benign
R4913:AI661453 UTSW 17 47468555 nonsense probably null
R6430:AI661453 UTSW 17 47466797 intron probably benign
R6687:AI661453 UTSW 17 47467002 intron probably benign
Predicted Primers PCR Primer
(F):5'- GCTGAACTAAAGAGGAGCCC -3'
(R):5'- TCCAGTCAACGGGTTCTGAC -3'

Sequencing Primer
(F):5'- TAGGACCTAGCCCAGAGCC -3'
(R):5'- GGATTTGGAGGTCTTCATAAATCCAG -3'
Posted On2016-04-27