Incidental Mutation 'R4979:Bank1'
ID384657
Institutional Source Beutler Lab
Gene Symbol Bank1
Ensembl Gene ENSMUSG00000037922
Gene NameB cell scaffold protein with ankyrin repeats 1
SynonymsA530094C12Rik
MMRRC Submission 042574-MU
Accession Numbers

Genbank: NM_001033350.2

Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R4979 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location136053363-136326066 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 136254901 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 198 (L198P)
Ref Sequence ENSEMBL: ENSMUSP00000035484 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041577] [ENSMUST00000196159] [ENSMUST00000198206]
Predicted Effect probably damaging
Transcript: ENSMUST00000041577
AA Change: L198P

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000035484
Gene: ENSMUSG00000037922
AA Change: L198P

DomainStartEndE-ValueType
DBB 197 327 1.24e-62 SMART
Blast:ANK 341 371 7e-12 BLAST
SCOP:d1awcb_ 344 398 2e-4 SMART
Blast:ANK 377 407 2e-6 BLAST
coiled coil region 465 486 N/A INTRINSIC
low complexity region 502 515 N/A INTRINSIC
coiled coil region 560 583 N/A INTRINSIC
low complexity region 609 622 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000196159
AA Change: L65P

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000142366
Gene: ENSMUSG00000037922
AA Change: L65P

DomainStartEndE-ValueType
DBB 64 194 1.24e-62 SMART
Blast:ANK 208 238 6e-12 BLAST
SCOP:d1awcb_ 211 265 1e-4 SMART
Blast:ANK 244 274 3e-6 BLAST
coiled coil region 332 353 N/A INTRINSIC
low complexity region 369 382 N/A INTRINSIC
coiled coil region 427 450 N/A INTRINSIC
low complexity region 476 489 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000198206
AA Change: L65P

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000142996
Gene: ENSMUSG00000037922
AA Change: L65P

DomainStartEndE-ValueType
DBB 64 194 5.9e-67 SMART
Blast:ANK 208 238 5e-12 BLAST
SCOP:d1awcb_ 211 265 1e-4 SMART
Blast:ANK 244 274 2e-6 BLAST
low complexity region 300 313 N/A INTRINSIC
coiled coil region 359 382 N/A INTRINSIC
low complexity region 408 421 N/A INTRINSIC
Meta Mutation Damage Score 0.0276 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.4%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a B-cell-specific scaffold protein that functions in B-cell receptor-induced calcium mobilization from intracellular stores. This protein can also promote Lyn-mediated tyrosine phosphorylation of inositol 1,4,5-trisphosphate receptors. Polymorphisms in this gene are associated with susceptibility to systemic lupus erythematosus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased germinal center formation and IgM production in response to T-dependent antigens, and show enhanced CD40-mediated B cell proliferative and survival responses. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, knock-out(1) Targeted, other(1)

Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik G A 17: 9,001,811 E381K probably damaging Het
Abca1 T C 4: 53,085,092 probably null Het
Abca7 C T 10: 80,004,783 Q870* probably null Het
Ambp C T 4: 63,152,651 V64M probably benign Het
Ank1 T C 8: 23,132,196 V1542A probably damaging Het
Anln T C 9: 22,376,501 Y168C probably benign Het
Apoa4 T A 9: 46,241,505 N29K probably benign Het
Arfgef1 T C 1: 10,213,109 T192A probably damaging Het
Atad2b G T 12: 5,034,513 D1420Y probably damaging Het
Baiap3 A G 17: 25,246,362 W648R possibly damaging Het
Bicd2 A G 13: 49,379,464 K509E possibly damaging Het
Cacna1e T C 1: 154,413,993 D1821G probably damaging Het
Ccdc80 G A 16: 45,116,287 V692M possibly damaging Het
Ccdc88a C T 11: 29,482,133 Q308* probably null Het
Ccl8 T C 11: 82,116,147 V62A probably damaging Het
Clspn C A 4: 126,578,386 P951Q probably damaging Het
Cngb1 T A 8: 95,259,157 I858F probably damaging Het
Cspp1 T A 1: 10,126,463 N900K probably damaging Het
Ctc1 C T 11: 69,033,502 A960V probably damaging Het
Ctnnd2 A G 15: 31,009,075 E1106G probably damaging Het
Dido1 C T 2: 180,660,813 R1766H probably damaging Het
Dnajc13 G T 9: 104,186,723 N1341K probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
E2f8 G A 7: 48,875,170 probably benign Het
Entpd8 A G 2: 25,082,955 D91G possibly damaging Het
Fam69a A T 5: 107,909,534 L386* probably null Het
Fars2 A G 13: 36,204,581 R18G possibly damaging Het
Fcgbp A G 7: 28,117,570 S2486G probably benign Het
Fibin C T 2: 110,362,618 D60N possibly damaging Het
Fpgs A G 2: 32,687,367 probably benign Het
Galnt15 A G 14: 32,043,290 D303G probably damaging Het
Gli3 C A 13: 15,724,464 T812K possibly damaging Het
Gpbar1 G C 1: 74,279,245 A216P probably benign Het
Grin2d A G 7: 45,857,933 I448T probably benign Het
Il21 C A 3: 37,232,504 S21I probably damaging Het
Iqce G T 5: 140,691,621 D148E probably damaging Het
Iqcg T A 16: 33,019,514 E354V probably damaging Het
Iws1 T C 18: 32,093,267 probably benign Het
Ly75 C T 2: 60,375,894 G144S probably damaging Het
Marco C A 1: 120,494,225 M83I probably benign Het
Mettl6 A T 14: 31,479,795 L185H probably damaging Het
Mppe1 C T 18: 67,229,702 G154D probably damaging Het
Mrpl42 T C 10: 95,490,375 E85G probably benign Het
Neb A G 2: 52,189,909 V5518A probably damaging Het
Olfr103 A T 17: 37,336,868 F121L probably benign Het
Olfr1458 A T 19: 13,102,689 I199N probably damaging Het
Olfr656 T A 7: 104,618,605 F317I probably null Het
Olfr77 G T 9: 19,920,359 S50I probably benign Het
Olfr8 T A 10: 78,955,932 C242* probably null Het
Perm1 A G 4: 156,217,577 T193A probably benign Het
Prkd2 T A 7: 16,848,727 C172S probably damaging Het
Prr23a3 T A 9: 98,865,378 D128E possibly damaging Het
Prss28 A G 17: 25,309,737 Y51C probably damaging Het
Psmb1 A T 17: 15,476,189 M85K probably benign Het
Rae1 T A 2: 173,012,608 probably benign Het
Rasal1 A G 5: 120,678,676 D759G probably benign Het
Rcvrn G A 11: 67,695,420 G2R probably damaging Het
Robo3 C T 9: 37,423,344 A597T probably damaging Het
Rsf1 GCG GCGACGGCGCCG 7: 97,579,907 probably benign Homo
Sdcbp T A 4: 6,378,980 Y22* probably null Het
Sin3a T C 9: 57,118,076 F1069L probably damaging Het
Slitrk3 C T 3: 73,049,796 V548I possibly damaging Het
Tbc1d22a A G 15: 86,391,086 H403R probably damaging Het
Tbr1 G T 2: 61,805,249 probably null Het
Tiam2 T A 17: 3,505,710 D65E probably damaging Het
Tpcn2 A G 7: 145,260,096 S488P probably benign Het
Trav9-2 T C 14: 53,591,238 S22P probably damaging Het
Trim34a T A 7: 104,247,862 N44K probably benign Het
Unc79 C G 12: 103,112,432 P1619A probably benign Het
Usp22 A T 11: 61,157,216 V426E probably damaging Het
Vhl A T 6: 113,624,198 M20L unknown Het
Vmn1r215 G A 13: 23,075,894 A35T probably benign Het
Vmn1r222 G A 13: 23,232,432 L204F possibly damaging Het
Zfp871 A T 17: 32,775,855 H115Q probably damaging Het
Zpr1 T A 9: 46,278,342 F340L probably benign Het
Other mutations in Bank1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00924:Bank1 APN 3 136247634 missense probably damaging 0.99
IGL03088:Bank1 APN 3 136093362 missense probably damaging 0.98
IGL03190:Bank1 APN 3 136100424 missense probably damaging 1.00
I2289:Bank1 UTSW 3 136054418 missense probably damaging 1.00
PIT4504001:Bank1 UTSW 3 136100419 missense probably damaging 1.00
R0193:Bank1 UTSW 3 136066518 splice site probably benign
R0423:Bank1 UTSW 3 136284017 missense possibly damaging 0.68
R0518:Bank1 UTSW 3 136213942 missense probably damaging 1.00
R0521:Bank1 UTSW 3 136213942 missense probably damaging 1.00
R0587:Bank1 UTSW 3 136214037 splice site probably benign
R0628:Bank1 UTSW 3 136066390 missense probably damaging 1.00
R0723:Bank1 UTSW 3 136054403 splice site probably null
R0811:Bank1 UTSW 3 136093366 missense probably damaging 1.00
R0812:Bank1 UTSW 3 136093366 missense probably damaging 1.00
R1101:Bank1 UTSW 3 136283864 missense probably benign 0.08
R1446:Bank1 UTSW 3 136064143 missense probably damaging 1.00
R1564:Bank1 UTSW 3 136213841 nonsense probably null
R1636:Bank1 UTSW 3 136083226 missense probably damaging 1.00
R1667:Bank1 UTSW 3 136093296 missense probably damaging 1.00
R1751:Bank1 UTSW 3 136234614 missense probably benign 0.00
R1751:Bank1 UTSW 3 136254937 missense probably benign 0.00
R2023:Bank1 UTSW 3 136325918 missense probably benign 0.02
R2851:Bank1 UTSW 3 136242940 missense possibly damaging 0.92
R2852:Bank1 UTSW 3 136242940 missense possibly damaging 0.92
R3411:Bank1 UTSW 3 136247773 splice site probably benign
R4422:Bank1 UTSW 3 136083211 missense probably damaging 0.99
R4499:Bank1 UTSW 3 136284243 missense probably benign 0.44
R4693:Bank1 UTSW 3 136247676 missense probably damaging 0.99
R4744:Bank1 UTSW 3 136247689 missense probably benign 0.12
R4791:Bank1 UTSW 3 136254929 missense probably benign 0.00
R4911:Bank1 UTSW 3 136284243 missense probably benign 0.44
R4967:Bank1 UTSW 3 136066373 missense probably damaging 1.00
R5119:Bank1 UTSW 3 136234682 missense possibly damaging 0.67
R5284:Bank1 UTSW 3 136064154 missense probably damaging 1.00
R5547:Bank1 UTSW 3 136066349 missense probably damaging 0.99
R5610:Bank1 UTSW 3 136066387 missense probably damaging 1.00
R6012:Bank1 UTSW 3 136213837 missense probably benign 0.44
R6087:Bank1 UTSW 3 136066429 missense probably damaging 1.00
R6753:Bank1 UTSW 3 136093308 missense probably damaging 1.00
R6764:Bank1 UTSW 3 136242940 missense probably damaging 0.97
R6861:Bank1 UTSW 3 136255003 missense probably benign 0.33
R7013:Bank1 UTSW 3 136100509 missense possibly damaging 0.74
V1662:Bank1 UTSW 3 136054418 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCCGTGTTTTATGAAAGGC -3'
(R):5'- TCCTGTACTGATGAAATTGGCC -3'

Sequencing Primer
(F):5'- CCGTGTTTTATGAAAGGCAAGCATC -3'
(R):5'- CTGTACTGATGAAATTGGCCTTTTAG -3'
Posted On2016-05-10