Incidental Mutation 'R4979:Sdcbp'
ID384658
Institutional Source Beutler Lab
Gene Symbol Sdcbp
Ensembl Gene ENSMUSG00000028249
Gene Namesyndecan binding protein
Synonymssyntenin-1, syndecan interacting protein, syntenin, Sycl, MDA-9
MMRRC Submission 042574-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.325) question?
Stock #R4979 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location6365650-6408423 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 6378980 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 22 (Y22*)
Ref Sequence ENSEMBL: ENSMUSP00000135777 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029912] [ENSMUST00000103008] [ENSMUST00000108374] [ENSMUST00000140830] [ENSMUST00000153861] [ENSMUST00000175769]
Predicted Effect probably null
Transcript: ENSMUST00000029912
AA Change: Y22*
SMART Domains Protein: ENSMUSP00000029912
Gene: ENSMUSG00000028249
AA Change: Y22*

DomainStartEndE-ValueType
PDZ 124 195 7.09e-15 SMART
PDZ 208 274 6.04e-9 SMART
Predicted Effect probably null
Transcript: ENSMUST00000103008
AA Change: Y22*
SMART Domains Protein: ENSMUSP00000100073
Gene: ENSMUSG00000028249
AA Change: Y22*

DomainStartEndE-ValueType
PDZ 123 194 7.09e-15 SMART
PDZ 207 273 6.04e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000108371
Predicted Effect probably null
Transcript: ENSMUST00000108374
AA Change: Y22*
SMART Domains Protein: ENSMUSP00000104011
Gene: ENSMUSG00000028249
AA Change: Y22*

DomainStartEndE-ValueType
PDZ 124 195 2.84e-14 SMART
Predicted Effect probably null
Transcript: ENSMUST00000140830
AA Change: Y22*
SMART Domains Protein: ENSMUSP00000122411
Gene: ENSMUSG00000028249
AA Change: Y22*

DomainStartEndE-ValueType
Blast:PDZ 56 91 1e-10 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000153861
AA Change: Y22*
SMART Domains Protein: ENSMUSP00000119838
Gene: ENSMUSG00000028249
AA Change: Y22*

DomainStartEndE-ValueType
PDZ 123 194 7.09e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155247
Predicted Effect probably null
Transcript: ENSMUST00000175769
AA Change: Y22*
SMART Domains Protein: ENSMUSP00000135777
Gene: ENSMUSG00000028249
AA Change: Y22*

DomainStartEndE-ValueType
PDZ 124 195 7.09e-15 SMART
Blast:PDZ 208 249 1e-21 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193139
Meta Mutation Damage Score 0.642 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.4%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene was initially identified as a molecule linking syndecan-mediated signaling to the cytoskeleton. The syntenin protein contains tandemly repeated PDZ domains that bind the cytoplasmic, C-terminal domains of a variety of transmembrane proteins. This protein may also affect cytoskeletal-membrane organization, cell adhesion, protein trafficking, and the activation of transcription factors. The protein is primarily localized to membrane-associated adherens junctions and focal adhesions but is also found at the endoplasmic reticulum and nucleus. Alternative splicing results in multiple transcript variants encoding different isoforms. Related pseudogenes have been identified on multiple chromosomes. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice heterozygous for a conditional allele activated in neurons exhibit abnormal dendrite morphology and reduced mEPSC frequency. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik G A 17: 9,001,811 E381K probably damaging Het
Abca1 T C 4: 53,085,092 probably null Het
Abca7 C T 10: 80,004,783 Q870* probably null Het
Ambp C T 4: 63,152,651 V64M probably benign Het
Ank1 T C 8: 23,132,196 V1542A probably damaging Het
Anln T C 9: 22,376,501 Y168C probably benign Het
Apoa4 T A 9: 46,241,505 N29K probably benign Het
Arfgef1 T C 1: 10,213,109 T192A probably damaging Het
Atad2b G T 12: 5,034,513 D1420Y probably damaging Het
Baiap3 A G 17: 25,246,362 W648R possibly damaging Het
Bank1 A G 3: 136,254,901 L198P probably damaging Het
Bicd2 A G 13: 49,379,464 K509E possibly damaging Het
Cacna1e T C 1: 154,413,993 D1821G probably damaging Het
Ccdc80 G A 16: 45,116,287 V692M possibly damaging Het
Ccdc88a C T 11: 29,482,133 Q308* probably null Het
Ccl8 T C 11: 82,116,147 V62A probably damaging Het
Clspn C A 4: 126,578,386 P951Q probably damaging Het
Cngb1 T A 8: 95,259,157 I858F probably damaging Het
Cspp1 T A 1: 10,126,463 N900K probably damaging Het
Ctc1 C T 11: 69,033,502 A960V probably damaging Het
Ctnnd2 A G 15: 31,009,075 E1106G probably damaging Het
Dido1 C T 2: 180,660,813 R1766H probably damaging Het
Dnajc13 G T 9: 104,186,723 N1341K probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
E2f8 G A 7: 48,875,170 probably benign Het
Entpd8 A G 2: 25,082,955 D91G possibly damaging Het
Fam69a A T 5: 107,909,534 L386* probably null Het
Fars2 A G 13: 36,204,581 R18G possibly damaging Het
Fcgbp A G 7: 28,117,570 S2486G probably benign Het
Fibin C T 2: 110,362,618 D60N possibly damaging Het
Fpgs A G 2: 32,687,367 probably benign Het
Galnt15 A G 14: 32,043,290 D303G probably damaging Het
Gli3 C A 13: 15,724,464 T812K possibly damaging Het
Gpbar1 G C 1: 74,279,245 A216P probably benign Het
Grin2d A G 7: 45,857,933 I448T probably benign Het
Il21 C A 3: 37,232,504 S21I probably damaging Het
Iqce G T 5: 140,691,621 D148E probably damaging Het
Iqcg T A 16: 33,019,514 E354V probably damaging Het
Iws1 T C 18: 32,093,267 probably benign Het
Ly75 C T 2: 60,375,894 G144S probably damaging Het
Marco C A 1: 120,494,225 M83I probably benign Het
Mettl6 A T 14: 31,479,795 L185H probably damaging Het
Mppe1 C T 18: 67,229,702 G154D probably damaging Het
Mrpl42 T C 10: 95,490,375 E85G probably benign Het
Neb A G 2: 52,189,909 V5518A probably damaging Het
Olfr103 A T 17: 37,336,868 F121L probably benign Het
Olfr1458 A T 19: 13,102,689 I199N probably damaging Het
Olfr656 T A 7: 104,618,605 F317I probably null Het
Olfr77 G T 9: 19,920,359 S50I probably benign Het
Olfr8 T A 10: 78,955,932 C242* probably null Het
Perm1 A G 4: 156,217,577 T193A probably benign Het
Prkd2 T A 7: 16,848,727 C172S probably damaging Het
Prr23a3 T A 9: 98,865,378 D128E possibly damaging Het
Prss28 A G 17: 25,309,737 Y51C probably damaging Het
Psmb1 A T 17: 15,476,189 M85K probably benign Het
Rae1 T A 2: 173,012,608 probably benign Het
Rasal1 A G 5: 120,678,676 D759G probably benign Het
Rcvrn G A 11: 67,695,420 G2R probably damaging Het
Robo3 C T 9: 37,423,344 A597T probably damaging Het
Rsf1 GCG GCGACGGCGCCG 7: 97,579,907 probably benign Homo
Sin3a T C 9: 57,118,076 F1069L probably damaging Het
Slitrk3 C T 3: 73,049,796 V548I possibly damaging Het
Tbc1d22a A G 15: 86,391,086 H403R probably damaging Het
Tbr1 G T 2: 61,805,249 probably null Het
Tiam2 T A 17: 3,505,710 D65E probably damaging Het
Tpcn2 A G 7: 145,260,096 S488P probably benign Het
Trav9-2 T C 14: 53,591,238 S22P probably damaging Het
Trim34a T A 7: 104,247,862 N44K probably benign Het
Unc79 C G 12: 103,112,432 P1619A probably benign Het
Usp22 A T 11: 61,157,216 V426E probably damaging Het
Vhl A T 6: 113,624,198 M20L unknown Het
Vmn1r215 G A 13: 23,075,894 A35T probably benign Het
Vmn1r222 G A 13: 23,232,432 L204F possibly damaging Het
Zfp871 A T 17: 32,775,855 H115Q probably damaging Het
Zpr1 T A 9: 46,278,342 F340L probably benign Het
Other mutations in Sdcbp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00983:Sdcbp APN 4 6392953 nonsense probably null
R0158:Sdcbp UTSW 4 6379042 missense possibly damaging 0.81
R1066:Sdcbp UTSW 4 6385120 missense probably damaging 0.98
R1115:Sdcbp UTSW 4 6377143 critical splice donor site probably null
R1353:Sdcbp UTSW 4 6381057 missense probably damaging 0.99
R2006:Sdcbp UTSW 4 6386536 missense probably benign 0.23
R4879:Sdcbp UTSW 4 6381056 missense possibly damaging 0.93
R5034:Sdcbp UTSW 4 6393118 critical splice donor site probably null
R5072:Sdcbp UTSW 4 6393019 missense probably benign 0.07
R6307:Sdcbp UTSW 4 6385059 missense probably benign 0.06
R6329:Sdcbp UTSW 4 6381064 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TCCTTTGGGTGAAAATGATTTCTG -3'
(R):5'- AGACTCACCTTCATACTCAAAGATCA -3'

Sequencing Primer
(F):5'- TGGGTGAAAATGATTTCTGAACTG -3'
(R):5'- TACTTCCATCTGGAGGGAG -3'
Posted On2016-05-10