Incidental Mutation 'R4979:Mrpl42'
ID384687
Institutional Source Beutler Lab
Gene Symbol Mrpl42
Ensembl Gene ENSMUSG00000062981
Gene Namemitochondrial ribosomal protein L42
SynonymsHSPC204, 2700009F22Rik, Rpml31, 2900055D03Rik, D10Ertd322e, PTD007, MRP-L31
MMRRC Submission 042574-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.775) question?
Stock #R4979 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location95480805-95501940 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 95490375 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 85 (E85G)
Ref Sequence ENSEMBL: ENSMUSP00000151636 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075829] [ENSMUST00000217777] [ENSMUST00000218893] [ENSMUST00000219019]
Predicted Effect probably benign
Transcript: ENSMUST00000075829
AA Change: E85G

PolyPhen 2 Score 0.414 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000075226
Gene: ENSMUSG00000062981
AA Change: E85G

DomainStartEndE-ValueType
Pfam:MRP-S32 45 142 6.8e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217777
Predicted Effect probably benign
Transcript: ENSMUST00000218893
AA Change: E85G

PolyPhen 2 Score 0.414 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218996
Predicted Effect probably benign
Transcript: ENSMUST00000219019
Meta Mutation Damage Score 0.428 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.4%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a protein identified as belonging to both the 28S and the 39S subunits. Alternative splicing results in multiple transcript variants. Pseudogenes corresponding to this gene are found on chromosomes 4q, 6p, 6q, 7p, and 15q. [provided by RefSeq, May 2011]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik G A 17: 9,001,811 E381K probably damaging Het
Abca1 T C 4: 53,085,092 probably null Het
Abca7 C T 10: 80,004,783 Q870* probably null Het
Ambp C T 4: 63,152,651 V64M probably benign Het
Ank1 T C 8: 23,132,196 V1542A probably damaging Het
Anln T C 9: 22,376,501 Y168C probably benign Het
Apoa4 T A 9: 46,241,505 N29K probably benign Het
Arfgef1 T C 1: 10,213,109 T192A probably damaging Het
Atad2b G T 12: 5,034,513 D1420Y probably damaging Het
Baiap3 A G 17: 25,246,362 W648R possibly damaging Het
Bank1 A G 3: 136,254,901 L198P probably damaging Het
Bicd2 A G 13: 49,379,464 K509E possibly damaging Het
Cacna1e T C 1: 154,413,993 D1821G probably damaging Het
Ccdc80 G A 16: 45,116,287 V692M possibly damaging Het
Ccdc88a C T 11: 29,482,133 Q308* probably null Het
Ccl8 T C 11: 82,116,147 V62A probably damaging Het
Clspn C A 4: 126,578,386 P951Q probably damaging Het
Cngb1 T A 8: 95,259,157 I858F probably damaging Het
Cspp1 T A 1: 10,126,463 N900K probably damaging Het
Ctc1 C T 11: 69,033,502 A960V probably damaging Het
Ctnnd2 A G 15: 31,009,075 E1106G probably damaging Het
Dido1 C T 2: 180,660,813 R1766H probably damaging Het
Dnajc13 G T 9: 104,186,723 N1341K probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
E2f8 G A 7: 48,875,170 probably benign Het
Entpd8 A G 2: 25,082,955 D91G possibly damaging Het
Fam69a A T 5: 107,909,534 L386* probably null Het
Fars2 A G 13: 36,204,581 R18G possibly damaging Het
Fcgbp A G 7: 28,117,570 S2486G probably benign Het
Fibin C T 2: 110,362,618 D60N possibly damaging Het
Fpgs A G 2: 32,687,367 probably benign Het
Galnt15 A G 14: 32,043,290 D303G probably damaging Het
Gli3 C A 13: 15,724,464 T812K possibly damaging Het
Gpbar1 G C 1: 74,279,245 A216P probably benign Het
Grin2d A G 7: 45,857,933 I448T probably benign Het
Il21 C A 3: 37,232,504 S21I probably damaging Het
Iqce G T 5: 140,691,621 D148E probably damaging Het
Iqcg T A 16: 33,019,514 E354V probably damaging Het
Iws1 T C 18: 32,093,267 probably benign Het
Ly75 C T 2: 60,375,894 G144S probably damaging Het
Marco C A 1: 120,494,225 M83I probably benign Het
Mettl6 A T 14: 31,479,795 L185H probably damaging Het
Mppe1 C T 18: 67,229,702 G154D probably damaging Het
Neb A G 2: 52,189,909 V5518A probably damaging Het
Olfr103 A T 17: 37,336,868 F121L probably benign Het
Olfr1458 A T 19: 13,102,689 I199N probably damaging Het
Olfr656 T A 7: 104,618,605 F317I probably null Het
Olfr77 G T 9: 19,920,359 S50I probably benign Het
Olfr8 T A 10: 78,955,932 C242* probably null Het
Perm1 A G 4: 156,217,577 T193A probably benign Het
Prkd2 T A 7: 16,848,727 C172S probably damaging Het
Prr23a3 T A 9: 98,865,378 D128E possibly damaging Het
Prss28 A G 17: 25,309,737 Y51C probably damaging Het
Psmb1 A T 17: 15,476,189 M85K probably benign Het
Rae1 T A 2: 173,012,608 probably benign Het
Rasal1 A G 5: 120,678,676 D759G probably benign Het
Rcvrn G A 11: 67,695,420 G2R probably damaging Het
Robo3 C T 9: 37,423,344 A597T probably damaging Het
Rsf1 GCG GCGACGGCGCCG 7: 97,579,907 probably benign Homo
Sdcbp T A 4: 6,378,980 Y22* probably null Het
Sin3a T C 9: 57,118,076 F1069L probably damaging Het
Slitrk3 C T 3: 73,049,796 V548I possibly damaging Het
Tbc1d22a A G 15: 86,391,086 H403R probably damaging Het
Tbr1 G T 2: 61,805,249 probably null Het
Tiam2 T A 17: 3,505,710 D65E probably damaging Het
Tpcn2 A G 7: 145,260,096 S488P probably benign Het
Trav9-2 T C 14: 53,591,238 S22P probably damaging Het
Trim34a T A 7: 104,247,862 N44K probably benign Het
Unc79 C G 12: 103,112,432 P1619A probably benign Het
Usp22 A T 11: 61,157,216 V426E probably damaging Het
Vhl A T 6: 113,624,198 M20L unknown Het
Vmn1r215 G A 13: 23,075,894 A35T probably benign Het
Vmn1r222 G A 13: 23,232,432 L204F possibly damaging Het
Zfp871 A T 17: 32,775,855 H115Q probably damaging Het
Zpr1 T A 9: 46,278,342 F340L probably benign Het
Other mutations in Mrpl42
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00984:Mrpl42 APN 10 95490340 missense probably benign
R1321:Mrpl42 UTSW 10 95493711 missense probably damaging 1.00
R5999:Mrpl42 UTSW 10 95500479 start gained probably benign
R6268:Mrpl42 UTSW 10 95496707 intron probably null
Predicted Primers PCR Primer
(F):5'- ACTTGGTCAATGTTCCCACACAG -3'
(R):5'- GAAGGTGCTCTGGTAACTTAACAC -3'

Sequencing Primer
(F):5'- CTGCAGAAGCTGTTGATGC -3'
(R):5'- GCTCTGGTAACTTAACACTGAATGGC -3'
Posted On2016-05-10