Incidental Mutation 'R4979:Bicd2'
ID384699
Institutional Source Beutler Lab
Gene Symbol Bicd2
Ensembl Gene ENSMUSG00000037933
Gene NameBICD cargo adaptor 2
Synonyms0610027D24Rik, 1110005D12Rik
MMRRC Submission 042574-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.694) question?
Stock #R4979 (G1)
Quality Score194
Status Validated
Chromosome13
Chromosomal Location49341585-49387026 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 49379464 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 509 (K509E)
Ref Sequence ENSEMBL: ENSMUSP00000105712 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048544] [ENSMUST00000110084] [ENSMUST00000110085] [ENSMUST00000220723]
Predicted Effect possibly damaging
Transcript: ENSMUST00000048544
AA Change: K509E

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000039394
Gene: ENSMUSG00000037933
AA Change: K509E

DomainStartEndE-ValueType
internal_repeat_1 22 50 2.25e-5 PROSPERO
Pfam:BicD 83 797 N/A PFAM
low complexity region 807 819 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000110084
AA Change: K435E

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000105711
Gene: ENSMUSG00000037933
AA Change: K435E

DomainStartEndE-ValueType
Pfam:BicD 9 723 N/A PFAM
low complexity region 733 745 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000110085
AA Change: K509E

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000105712
Gene: ENSMUSG00000037933
AA Change: K509E

DomainStartEndE-ValueType
internal_repeat_1 22 50 1.16e-5 PROSPERO
Pfam:BicD 83 797 N/A PFAM
low complexity region 807 819 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000220723
Meta Mutation Damage Score 0.074 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.4%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of two human homologs of Drosophila bicaudal-D and a member of the Bicoid family. It has been implicated in dynein-mediated, minus end-directed motility along microtubules. It has also been reported to be a phosphorylation target of NIMA related kinase 8. Two alternative splice variants have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele show postnatal and premature death associated with progressive hydrocephalus, enlarged lateral ventricles, aqueductal stenosis, abnormal gait, disrupted laminar organization of the cerebral cortex and cerebellum, and impaired cerebellar granule cell migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik G A 17: 9,001,811 E381K probably damaging Het
Abca1 T C 4: 53,085,092 probably null Het
Abca7 C T 10: 80,004,783 Q870* probably null Het
Ambp C T 4: 63,152,651 V64M probably benign Het
Ank1 T C 8: 23,132,196 V1542A probably damaging Het
Anln T C 9: 22,376,501 Y168C probably benign Het
Apoa4 T A 9: 46,241,505 N29K probably benign Het
Arfgef1 T C 1: 10,213,109 T192A probably damaging Het
Atad2b G T 12: 5,034,513 D1420Y probably damaging Het
Baiap3 A G 17: 25,246,362 W648R possibly damaging Het
Bank1 A G 3: 136,254,901 L198P probably damaging Het
Cacna1e T C 1: 154,413,993 D1821G probably damaging Het
Ccdc80 G A 16: 45,116,287 V692M possibly damaging Het
Ccdc88a C T 11: 29,482,133 Q308* probably null Het
Ccl8 T C 11: 82,116,147 V62A probably damaging Het
Clspn C A 4: 126,578,386 P951Q probably damaging Het
Cngb1 T A 8: 95,259,157 I858F probably damaging Het
Cspp1 T A 1: 10,126,463 N900K probably damaging Het
Ctc1 C T 11: 69,033,502 A960V probably damaging Het
Ctnnd2 A G 15: 31,009,075 E1106G probably damaging Het
Dido1 C T 2: 180,660,813 R1766H probably damaging Het
Dnajc13 G T 9: 104,186,723 N1341K probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
E2f8 G A 7: 48,875,170 probably benign Het
Entpd8 A G 2: 25,082,955 D91G possibly damaging Het
Fam69a A T 5: 107,909,534 L386* probably null Het
Fars2 A G 13: 36,204,581 R18G possibly damaging Het
Fcgbp A G 7: 28,117,570 S2486G probably benign Het
Fibin C T 2: 110,362,618 D60N possibly damaging Het
Fpgs A G 2: 32,687,367 probably benign Het
Galnt15 A G 14: 32,043,290 D303G probably damaging Het
Gli3 C A 13: 15,724,464 T812K possibly damaging Het
Gpbar1 G C 1: 74,279,245 A216P probably benign Het
Grin2d A G 7: 45,857,933 I448T probably benign Het
Il21 C A 3: 37,232,504 S21I probably damaging Het
Iqce G T 5: 140,691,621 D148E probably damaging Het
Iqcg T A 16: 33,019,514 E354V probably damaging Het
Iws1 T C 18: 32,093,267 probably benign Het
Ly75 C T 2: 60,375,894 G144S probably damaging Het
Marco C A 1: 120,494,225 M83I probably benign Het
Mettl6 A T 14: 31,479,795 L185H probably damaging Het
Mppe1 C T 18: 67,229,702 G154D probably damaging Het
Mrpl42 T C 10: 95,490,375 E85G probably benign Het
Neb A G 2: 52,189,909 V5518A probably damaging Het
Olfr103 A T 17: 37,336,868 F121L probably benign Het
Olfr1458 A T 19: 13,102,689 I199N probably damaging Het
Olfr656 T A 7: 104,618,605 F317I probably null Het
Olfr77 G T 9: 19,920,359 S50I probably benign Het
Olfr8 T A 10: 78,955,932 C242* probably null Het
Perm1 A G 4: 156,217,577 T193A probably benign Het
Prkd2 T A 7: 16,848,727 C172S probably damaging Het
Prr23a3 T A 9: 98,865,378 D128E possibly damaging Het
Prss28 A G 17: 25,309,737 Y51C probably damaging Het
Psmb1 A T 17: 15,476,189 M85K probably benign Het
Rae1 T A 2: 173,012,608 probably benign Het
Rasal1 A G 5: 120,678,676 D759G probably benign Het
Rcvrn G A 11: 67,695,420 G2R probably damaging Het
Robo3 C T 9: 37,423,344 A597T probably damaging Het
Rsf1 GCG GCGACGGCGCCG 7: 97,579,907 probably benign Homo
Sdcbp T A 4: 6,378,980 Y22* probably null Het
Sin3a T C 9: 57,118,076 F1069L probably damaging Het
Slitrk3 C T 3: 73,049,796 V548I possibly damaging Het
Tbc1d22a A G 15: 86,391,086 H403R probably damaging Het
Tbr1 G T 2: 61,805,249 probably null Het
Tiam2 T A 17: 3,505,710 D65E probably damaging Het
Tpcn2 A G 7: 145,260,096 S488P probably benign Het
Trav9-2 T C 14: 53,591,238 S22P probably damaging Het
Trim34a T A 7: 104,247,862 N44K probably benign Het
Unc79 C G 12: 103,112,432 P1619A probably benign Het
Usp22 A T 11: 61,157,216 V426E probably damaging Het
Vhl A T 6: 113,624,198 M20L unknown Het
Vmn1r215 G A 13: 23,075,894 A35T probably benign Het
Vmn1r222 G A 13: 23,232,432 L204F possibly damaging Het
Zfp871 A T 17: 32,775,855 H115Q probably damaging Het
Zpr1 T A 9: 46,278,342 F340L probably benign Het
Other mutations in Bicd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01070:Bicd2 APN 13 49378316 missense probably damaging 1.00
IGL02029:Bicd2 APN 13 49369499 missense probably damaging 1.00
IGL02052:Bicd2 APN 13 49379189 missense possibly damaging 0.91
IGL02955:Bicd2 APN 13 49378215 missense probably benign
IGL03033:Bicd2 APN 13 49379920 missense probably benign 0.09
IGL03395:Bicd2 APN 13 49375258 missense probably damaging 1.00
IGL02802:Bicd2 UTSW 13 49378328 missense probably damaging 1.00
P0027:Bicd2 UTSW 13 49379651 missense probably benign 0.05
R0052:Bicd2 UTSW 13 49375314 missense probably damaging 1.00
R0052:Bicd2 UTSW 13 49375314 missense probably damaging 1.00
R0393:Bicd2 UTSW 13 49379870 missense probably damaging 1.00
R0718:Bicd2 UTSW 13 49377875 splice site probably null
R0730:Bicd2 UTSW 13 49378241 missense possibly damaging 0.77
R1716:Bicd2 UTSW 13 49378310 missense probably benign
R2004:Bicd2 UTSW 13 49379405 missense possibly damaging 0.50
R2041:Bicd2 UTSW 13 49341776 missense probably benign 0.02
R2151:Bicd2 UTSW 13 49379576 missense probably damaging 1.00
R2152:Bicd2 UTSW 13 49379576 missense probably damaging 1.00
R2444:Bicd2 UTSW 13 49379024 missense probably benign 0.00
R4085:Bicd2 UTSW 13 49384962 splice site probably null
R4477:Bicd2 UTSW 13 49377972 missense probably damaging 1.00
R4824:Bicd2 UTSW 13 49379012 missense probably damaging 1.00
R6348:Bicd2 UTSW 13 49379846 missense probably damaging 1.00
T0722:Bicd2 UTSW 13 49379651 missense probably benign 0.05
X0003:Bicd2 UTSW 13 49379651 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- ATCAATGGGCCTGAGATCCTG -3'
(R):5'- AACTGGGTGAAGGACTGTTG -3'

Sequencing Primer
(F):5'- TGAGATCCTGGCCTGCAAGTAC -3'
(R):5'- CCCTTGGGCAAGAGGACAG -3'
Posted On2016-05-10