Incidental Mutation 'R4979:Ccdc80'
ID384706
Institutional Source Beutler Lab
Gene Symbol Ccdc80
Ensembl Gene ENSMUSG00000022665
Gene Namecoiled-coil domain containing 80
SynonymsDRO1, Urb, Ssg1, 2610001E17Rik
MMRRC Submission 042574-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R4979 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location45093402-45128077 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 45116287 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 692 (V692M)
Ref Sequence ENSEMBL: ENSMUSP00000097097 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061050] [ENSMUST00000099498]
Predicted Effect possibly damaging
Transcript: ENSMUST00000061050
AA Change: V692M

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000058752
Gene: ENSMUSG00000022665
AA Change: V692M

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:DUF4174 141 270 2.2e-31 PFAM
low complexity region 294 308 N/A INTRINSIC
low complexity region 335 380 N/A INTRINSIC
low complexity region 482 497 N/A INTRINSIC
coiled coil region 554 587 N/A INTRINSIC
Pfam:DUF4174 614 748 3.1e-36 PFAM
Pfam:DUF4174 770 901 2.1e-36 PFAM
low complexity region 917 940 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000099498
AA Change: V692M

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000097097
Gene: ENSMUSG00000022665
AA Change: V692M

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:DUF4174 140 271 8.9e-34 PFAM
low complexity region 294 308 N/A INTRINSIC
low complexity region 335 380 N/A INTRINSIC
low complexity region 482 497 N/A INTRINSIC
coiled coil region 554 587 N/A INTRINSIC
Pfam:DUF4174 613 749 1.4e-21 PFAM
Pfam:DUF4174 769 902 3.5e-39 PFAM
low complexity region 917 940 N/A INTRINSIC
Meta Mutation Damage Score 0.0468 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.4%
Validation Efficiency 99% (79/80)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit increased adiposity, hyperglycemia, glucose intolerance, impaired insulin secretion, and altered energy intake and expenditure when fed a high-fat diet. Mice homozygous for a different null allele develop thyroid adenomas and ovarian carcinomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik G A 17: 9,001,811 E381K probably damaging Het
Abca1 T C 4: 53,085,092 probably null Het
Abca7 C T 10: 80,004,783 Q870* probably null Het
Ambp C T 4: 63,152,651 V64M probably benign Het
Ank1 T C 8: 23,132,196 V1542A probably damaging Het
Anln T C 9: 22,376,501 Y168C probably benign Het
Apoa4 T A 9: 46,241,505 N29K probably benign Het
Arfgef1 T C 1: 10,213,109 T192A probably damaging Het
Atad2b G T 12: 5,034,513 D1420Y probably damaging Het
Baiap3 A G 17: 25,246,362 W648R possibly damaging Het
Bank1 A G 3: 136,254,901 L198P probably damaging Het
Bicd2 A G 13: 49,379,464 K509E possibly damaging Het
Cacna1e T C 1: 154,413,993 D1821G probably damaging Het
Ccdc88a C T 11: 29,482,133 Q308* probably null Het
Ccl8 T C 11: 82,116,147 V62A probably damaging Het
Clspn C A 4: 126,578,386 P951Q probably damaging Het
Cngb1 T A 8: 95,259,157 I858F probably damaging Het
Cspp1 T A 1: 10,126,463 N900K probably damaging Het
Ctc1 C T 11: 69,033,502 A960V probably damaging Het
Ctnnd2 A G 15: 31,009,075 E1106G probably damaging Het
Dido1 C T 2: 180,660,813 R1766H probably damaging Het
Dnajc13 G T 9: 104,186,723 N1341K probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
E2f8 G A 7: 48,875,170 probably benign Het
Entpd8 A G 2: 25,082,955 D91G possibly damaging Het
Fam69a A T 5: 107,909,534 L386* probably null Het
Fars2 A G 13: 36,204,581 R18G possibly damaging Het
Fcgbp A G 7: 28,117,570 S2486G probably benign Het
Fibin C T 2: 110,362,618 D60N possibly damaging Het
Fpgs A G 2: 32,687,367 probably benign Het
Galnt15 A G 14: 32,043,290 D303G probably damaging Het
Gli3 C A 13: 15,724,464 T812K possibly damaging Het
Gpbar1 G C 1: 74,279,245 A216P probably benign Het
Grin2d A G 7: 45,857,933 I448T probably benign Het
Il21 C A 3: 37,232,504 S21I probably damaging Het
Iqce G T 5: 140,691,621 D148E probably damaging Het
Iqcg T A 16: 33,019,514 E354V probably damaging Het
Iws1 T C 18: 32,093,267 probably benign Het
Ly75 C T 2: 60,375,894 G144S probably damaging Het
Marco C A 1: 120,494,225 M83I probably benign Het
Mettl6 A T 14: 31,479,795 L185H probably damaging Het
Mppe1 C T 18: 67,229,702 G154D probably damaging Het
Mrpl42 T C 10: 95,490,375 E85G probably benign Het
Neb A G 2: 52,189,909 V5518A probably damaging Het
Olfr103 A T 17: 37,336,868 F121L probably benign Het
Olfr1458 A T 19: 13,102,689 I199N probably damaging Het
Olfr656 T A 7: 104,618,605 F317I probably null Het
Olfr77 G T 9: 19,920,359 S50I probably benign Het
Olfr8 T A 10: 78,955,932 C242* probably null Het
Perm1 A G 4: 156,217,577 T193A probably benign Het
Prkd2 T A 7: 16,848,727 C172S probably damaging Het
Prr23a3 T A 9: 98,865,378 D128E possibly damaging Het
Prss28 A G 17: 25,309,737 Y51C probably damaging Het
Psmb1 A T 17: 15,476,189 M85K probably benign Het
Rae1 T A 2: 173,012,608 probably benign Het
Rasal1 A G 5: 120,678,676 D759G probably benign Het
Rcvrn G A 11: 67,695,420 G2R probably damaging Het
Robo3 C T 9: 37,423,344 A597T probably damaging Het
Rsf1 GCG GCGACGGCGCCG 7: 97,579,907 probably benign Homo
Sdcbp T A 4: 6,378,980 Y22* probably null Het
Sin3a T C 9: 57,118,076 F1069L probably damaging Het
Slitrk3 C T 3: 73,049,796 V548I possibly damaging Het
Tbc1d22a A G 15: 86,391,086 H403R probably damaging Het
Tbr1 G T 2: 61,805,249 probably null Het
Tiam2 T A 17: 3,505,710 D65E probably damaging Het
Tpcn2 A G 7: 145,260,096 S488P probably benign Het
Trav9-2 T C 14: 53,591,238 S22P probably damaging Het
Trim34a T A 7: 104,247,862 N44K probably benign Het
Unc79 C G 12: 103,112,432 P1619A probably benign Het
Usp22 A T 11: 61,157,216 V426E probably damaging Het
Vhl A T 6: 113,624,198 M20L unknown Het
Vmn1r215 G A 13: 23,075,894 A35T probably benign Het
Vmn1r222 G A 13: 23,232,432 L204F possibly damaging Het
Zfp871 A T 17: 32,775,855 H115Q probably damaging Het
Zpr1 T A 9: 46,278,342 F340L probably benign Het
Other mutations in Ccdc80
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00977:Ccdc80 APN 16 45096264 missense probably benign 0.07
IGL01781:Ccdc80 APN 16 45126130 missense probably damaging 1.00
IGL01945:Ccdc80 APN 16 45118245 missense probably damaging 0.99
IGL02163:Ccdc80 APN 16 45096114 missense probably benign
IGL02223:Ccdc80 APN 16 45095603 missense probably damaging 1.00
IGL02573:Ccdc80 APN 16 45095589 missense probably damaging 1.00
IGL02675:Ccdc80 APN 16 45116332 missense probably damaging 1.00
IGL02689:Ccdc80 APN 16 45096409 nonsense probably null
R0219:Ccdc80 UTSW 16 45096483 missense probably damaging 1.00
R0383:Ccdc80 UTSW 16 45095369 missense probably damaging 1.00
R1537:Ccdc80 UTSW 16 45095936 missense probably benign 0.21
R1726:Ccdc80 UTSW 16 45096005 missense probably benign 0.04
R1885:Ccdc80 UTSW 16 45096720 missense probably benign 0.09
R2021:Ccdc80 UTSW 16 45122912 missense probably damaging 1.00
R2140:Ccdc80 UTSW 16 45127446 missense probably damaging 1.00
R2186:Ccdc80 UTSW 16 45118105 missense probably damaging 1.00
R3896:Ccdc80 UTSW 16 45096621 missense probably benign 0.11
R3941:Ccdc80 UTSW 16 45096092 missense probably benign
R3971:Ccdc80 UTSW 16 45095820 missense probably benign 0.22
R4082:Ccdc80 UTSW 16 45122927 missense probably damaging 1.00
R4322:Ccdc80 UTSW 16 45095588 missense probably damaging 1.00
R4578:Ccdc80 UTSW 16 45095486 missense probably damaging 1.00
R4604:Ccdc80 UTSW 16 45095565 missense probably damaging 1.00
R4868:Ccdc80 UTSW 16 45104413 missense probably damaging 1.00
R4896:Ccdc80 UTSW 16 45095898 missense probably benign
R4921:Ccdc80 UTSW 16 45118167 missense probably damaging 1.00
R5452:Ccdc80 UTSW 16 45118165 missense probably damaging 1.00
R5454:Ccdc80 UTSW 16 45127225 nonsense probably null
R5594:Ccdc80 UTSW 16 45116263 missense probably benign 0.00
R5661:Ccdc80 UTSW 16 45127445 missense probably damaging 1.00
R5701:Ccdc80 UTSW 16 45116378 missense possibly damaging 0.51
R6106:Ccdc80 UTSW 16 45096710 missense probably benign 0.00
R6393:Ccdc80 UTSW 16 45096465 missense possibly damaging 0.88
R6633:Ccdc80 UTSW 16 45094908 missense possibly damaging 0.95
R6943:Ccdc80 UTSW 16 45095082 missense probably benign 0.00
R7021:Ccdc80 UTSW 16 45104441 missense probably damaging 1.00
R7030:Ccdc80 UTSW 16 45122889 missense possibly damaging 0.60
R7208:Ccdc80 UTSW 16 45096710 missense probably benign 0.12
X0012:Ccdc80 UTSW 16 45096425 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- CTGTAAAACTGTTCCCACACATTG -3'
(R):5'- TTACAAACCTTGCCAGTAGGG -3'

Sequencing Primer
(F):5'- GAATGGTCTGCTTTGAGCT -3'
(R):5'- GCACCGTTTGTGGACTTATTGACC -3'
Posted On2016-05-10