Incidental Mutation 'R4979:1700010I14Rik'
List |< first << previous [record 48 of 32981] next >> last >|
ID384707
Institutional Source Beutler Lab
Gene Symbol 1700010I14Rik
Ensembl Gene ENSMUSG00000023873
Gene NameRIKEN cDNA 1700010I14 gene
Synonyms
MMRRC Submission 042574-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.034) question?
Stock #R4979 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location8988333-9008319 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 9001811 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 381 (E381K)
Ref Sequence ENSEMBL: ENSMUSP00000118841 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024650] [ENSMUST00000151609]
Predicted Effect probably damaging
Transcript: ENSMUST00000024650
AA Change: E381K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000024650
Gene: ENSMUSG00000023873
AA Change: E381K

DomainStartEndE-ValueType
coiled coil region 135 165 N/A INTRINSIC
Pfam:TSNAXIP1_N 239 349 6.1e-36 PFAM
low complexity region 351 364 N/A INTRINSIC
low complexity region 372 385 N/A INTRINSIC
coiled coil region 421 466 N/A INTRINSIC
low complexity region 501 519 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136954
Predicted Effect probably damaging
Transcript: ENSMUST00000151609
AA Change: E381K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118841
Gene: ENSMUSG00000023873
AA Change: E381K

DomainStartEndE-ValueType
coiled coil region 135 165 N/A INTRINSIC
coiled coil region 321 370 N/A INTRINSIC
low complexity region 372 385 N/A INTRINSIC
coiled coil region 421 466 N/A INTRINSIC
Meta Mutation Damage Score 0.126 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.4%
Validation Efficiency 99% (79/80)
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 T C 4: 53,085,092 probably null Het
Abca7 C T 10: 80,004,783 Q870* probably null Het
Ambp C T 4: 63,152,651 V64M probably benign Het
Ank1 T C 8: 23,132,196 V1542A probably damaging Het
Anln T C 9: 22,376,501 Y168C probably benign Het
Apoa4 T A 9: 46,241,505 N29K probably benign Het
Arfgef1 T C 1: 10,213,109 T192A probably damaging Het
Atad2b G T 12: 5,034,513 D1420Y probably damaging Het
Baiap3 A G 17: 25,246,362 W648R possibly damaging Het
Bank1 A G 3: 136,254,901 L198P probably damaging Het
Bicd2 A G 13: 49,379,464 K509E possibly damaging Het
Cacna1e T C 1: 154,413,993 D1821G probably damaging Het
Ccdc80 G A 16: 45,116,287 V692M possibly damaging Het
Ccdc88a C T 11: 29,482,133 Q308* probably null Het
Ccl8 T C 11: 82,116,147 V62A probably damaging Het
Clspn C A 4: 126,578,386 P951Q probably damaging Het
Cngb1 T A 8: 95,259,157 I858F probably damaging Het
Cspp1 T A 1: 10,126,463 N900K probably damaging Het
Ctc1 C T 11: 69,033,502 A960V probably damaging Het
Ctnnd2 A G 15: 31,009,075 E1106G probably damaging Het
Dido1 C T 2: 180,660,813 R1766H probably damaging Het
Dnajc13 G T 9: 104,186,723 N1341K probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
E2f8 G A 7: 48,875,170 probably benign Het
Entpd8 A G 2: 25,082,955 D91G possibly damaging Het
Fam69a A T 5: 107,909,534 L386* probably null Het
Fars2 A G 13: 36,204,581 R18G possibly damaging Het
Fcgbp A G 7: 28,117,570 S2486G probably benign Het
Fibin C T 2: 110,362,618 D60N possibly damaging Het
Fpgs A G 2: 32,687,367 probably benign Het
Galnt15 A G 14: 32,043,290 D303G probably damaging Het
Gli3 C A 13: 15,724,464 T812K possibly damaging Het
Gpbar1 G C 1: 74,279,245 A216P probably benign Het
Grin2d A G 7: 45,857,933 I448T probably benign Het
Il21 C A 3: 37,232,504 S21I probably damaging Het
Iqce G T 5: 140,691,621 D148E probably damaging Het
Iqcg T A 16: 33,019,514 E354V probably damaging Het
Iws1 T C 18: 32,093,267 probably benign Het
Ly75 C T 2: 60,375,894 G144S probably damaging Het
Marco C A 1: 120,494,225 M83I probably benign Het
Mettl6 A T 14: 31,479,795 L185H probably damaging Het
Mppe1 C T 18: 67,229,702 G154D probably damaging Het
Mrpl42 T C 10: 95,490,375 E85G probably benign Het
Neb A G 2: 52,189,909 V5518A probably damaging Het
Olfr103 A T 17: 37,336,868 F121L probably benign Het
Olfr1458 A T 19: 13,102,689 I199N probably damaging Het
Olfr656 T A 7: 104,618,605 F317I probably null Het
Olfr77 G T 9: 19,920,359 S50I probably benign Het
Olfr8 T A 10: 78,955,932 C242* probably null Het
Perm1 A G 4: 156,217,577 T193A probably benign Het
Prkd2 T A 7: 16,848,727 C172S probably damaging Het
Prr23a3 T A 9: 98,865,378 D128E possibly damaging Het
Prss28 A G 17: 25,309,737 Y51C probably damaging Het
Psmb1 A T 17: 15,476,189 M85K probably benign Het
Rae1 T A 2: 173,012,608 probably benign Het
Rasal1 A G 5: 120,678,676 D759G probably benign Het
Rcvrn G A 11: 67,695,420 G2R probably damaging Het
Robo3 C T 9: 37,423,344 A597T probably damaging Het
Rsf1 GCG GCGACGGCGCCG 7: 97,579,907 probably benign Homo
Sdcbp T A 4: 6,378,980 Y22* probably null Het
Sin3a T C 9: 57,118,076 F1069L probably damaging Het
Slitrk3 C T 3: 73,049,796 V548I possibly damaging Het
Tbc1d22a A G 15: 86,391,086 H403R probably damaging Het
Tbr1 G T 2: 61,805,249 probably null Het
Tiam2 T A 17: 3,505,710 D65E probably damaging Het
Tpcn2 A G 7: 145,260,096 S488P probably benign Het
Trav9-2 T C 14: 53,591,238 S22P probably damaging Het
Trim34a T A 7: 104,247,862 N44K probably benign Het
Unc79 C G 12: 103,112,432 P1619A probably benign Het
Usp22 A T 11: 61,157,216 V426E probably damaging Het
Vhl A T 6: 113,624,198 M20L unknown Het
Vmn1r215 G A 13: 23,075,894 A35T probably benign Het
Vmn1r222 G A 13: 23,232,432 L204F possibly damaging Het
Zfp871 A T 17: 32,775,855 H115Q probably damaging Het
Zpr1 T A 9: 46,278,342 F340L probably benign Het
Other mutations in 1700010I14Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00988:1700010I14Rik APN 17 8997105 critical splice donor site probably null
IGL01569:1700010I14Rik APN 17 8996995 missense probably benign 0.33
IGL03024:1700010I14Rik APN 17 8993632 missense probably benign 0.33
IGL03410:1700010I14Rik APN 17 9001896 missense probably damaging 1.00
R0017:1700010I14Rik UTSW 17 9008106 utr 3 prime probably benign
R0017:1700010I14Rik UTSW 17 9008106 utr 3 prime probably benign
R0324:1700010I14Rik UTSW 17 9001157 missense probably benign 0.33
R0361:1700010I14Rik UTSW 17 8992546 missense probably benign 0.39
R0482:1700010I14Rik UTSW 17 8988423 critical splice donor site probably null
R0529:1700010I14Rik UTSW 17 8992396 missense probably benign 0.32
R1102:1700010I14Rik UTSW 17 8992628 missense probably damaging 1.00
R1964:1700010I14Rik UTSW 17 8992492 missense probably damaging 0.99
R3620:1700010I14Rik UTSW 17 9008032 missense probably benign 0.15
R4259:1700010I14Rik UTSW 17 8995234 missense probably damaging 1.00
R4261:1700010I14Rik UTSW 17 8995234 missense probably damaging 1.00
R4687:1700010I14Rik UTSW 17 8992153 missense probably damaging 1.00
R4707:1700010I14Rik UTSW 17 9005712 missense probably damaging 1.00
R4839:1700010I14Rik UTSW 17 9008013 missense probably benign 0.41
R5225:1700010I14Rik UTSW 17 9008007 nonsense probably null
R5383:1700010I14Rik UTSW 17 8992700 missense possibly damaging 0.86
R6031:1700010I14Rik UTSW 17 8995252 missense possibly damaging 0.85
R6031:1700010I14Rik UTSW 17 8995252 missense possibly damaging 0.85
R6505:1700010I14Rik UTSW 17 9001940 missense probably benign 0.08
R6736:1700010I14Rik UTSW 17 8992268 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGATTACCCTGTTTCTTTGGAAC -3'
(R):5'- CCACCTCAGCTATTGAAGGG -3'

Sequencing Primer
(F):5'- AATCTGTTTGAGTGACACTAAGC -3'
(R):5'- GGAGAGCATATTTTGGACTAAGCTTC -3'
Posted On2016-05-10