Incidental Mutation 'R4979:Olfr1458'
ID384714
Institutional Source Beutler Lab
Gene Symbol Olfr1458
Ensembl Gene ENSMUSG00000062844
Gene Nameolfactory receptor 1458
SynonymsEG667271, MOR202-24, GA_x6K02T2RE5P-3430689-3429787
MMRRC Submission 042574-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R4979 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location13101593-13106775 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 13102689 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 199 (I199N)
Ref Sequence ENSEMBL: ENSMUSP00000076019 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076729] [ENSMUST00000207340] [ENSMUST00000208913] [ENSMUST00000215160] [ENSMUST00000215229]
Predicted Effect probably damaging
Transcript: ENSMUST00000076729
AA Change: I199N

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000076019
Gene: ENSMUSG00000062844
AA Change: I199N

DomainStartEndE-ValueType
Pfam:7tm_4 23 300 7.9e-51 PFAM
Pfam:7TM_GPCR_Srsx 27 297 1.2e-6 PFAM
Pfam:7tm_1 33 282 5.8e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207340
AA Change: I205N
Predicted Effect probably benign
Transcript: ENSMUST00000208913
Predicted Effect probably benign
Transcript: ENSMUST00000215160
AA Change: I205N

PolyPhen 2 Score 0.287 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000215229
Meta Mutation Damage Score 0.11 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.4%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik G A 17: 9,001,811 E381K probably damaging Het
Abca1 T C 4: 53,085,092 probably null Het
Abca7 C T 10: 80,004,783 Q870* probably null Het
Ambp C T 4: 63,152,651 V64M probably benign Het
Ank1 T C 8: 23,132,196 V1542A probably damaging Het
Anln T C 9: 22,376,501 Y168C probably benign Het
Apoa4 T A 9: 46,241,505 N29K probably benign Het
Arfgef1 T C 1: 10,213,109 T192A probably damaging Het
Atad2b G T 12: 5,034,513 D1420Y probably damaging Het
Baiap3 A G 17: 25,246,362 W648R possibly damaging Het
Bank1 A G 3: 136,254,901 L198P probably damaging Het
Bicd2 A G 13: 49,379,464 K509E possibly damaging Het
Cacna1e T C 1: 154,413,993 D1821G probably damaging Het
Ccdc80 G A 16: 45,116,287 V692M possibly damaging Het
Ccdc88a C T 11: 29,482,133 Q308* probably null Het
Ccl8 T C 11: 82,116,147 V62A probably damaging Het
Clspn C A 4: 126,578,386 P951Q probably damaging Het
Cngb1 T A 8: 95,259,157 I858F probably damaging Het
Cspp1 T A 1: 10,126,463 N900K probably damaging Het
Ctc1 C T 11: 69,033,502 A960V probably damaging Het
Ctnnd2 A G 15: 31,009,075 E1106G probably damaging Het
Dido1 C T 2: 180,660,813 R1766H probably damaging Het
Dnajc13 G T 9: 104,186,723 N1341K probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
E2f8 G A 7: 48,875,170 probably benign Het
Entpd8 A G 2: 25,082,955 D91G possibly damaging Het
Fam69a A T 5: 107,909,534 L386* probably null Het
Fars2 A G 13: 36,204,581 R18G possibly damaging Het
Fcgbp A G 7: 28,117,570 S2486G probably benign Het
Fibin C T 2: 110,362,618 D60N possibly damaging Het
Fpgs A G 2: 32,687,367 probably benign Het
Galnt15 A G 14: 32,043,290 D303G probably damaging Het
Gli3 C A 13: 15,724,464 T812K possibly damaging Het
Gpbar1 G C 1: 74,279,245 A216P probably benign Het
Grin2d A G 7: 45,857,933 I448T probably benign Het
Il21 C A 3: 37,232,504 S21I probably damaging Het
Iqce G T 5: 140,691,621 D148E probably damaging Het
Iqcg T A 16: 33,019,514 E354V probably damaging Het
Iws1 T C 18: 32,093,267 probably benign Het
Ly75 C T 2: 60,375,894 G144S probably damaging Het
Marco C A 1: 120,494,225 M83I probably benign Het
Mettl6 A T 14: 31,479,795 L185H probably damaging Het
Mppe1 C T 18: 67,229,702 G154D probably damaging Het
Mrpl42 T C 10: 95,490,375 E85G probably benign Het
Neb A G 2: 52,189,909 V5518A probably damaging Het
Olfr103 A T 17: 37,336,868 F121L probably benign Het
Olfr656 T A 7: 104,618,605 F317I probably null Het
Olfr77 G T 9: 19,920,359 S50I probably benign Het
Olfr8 T A 10: 78,955,932 C242* probably null Het
Perm1 A G 4: 156,217,577 T193A probably benign Het
Prkd2 T A 7: 16,848,727 C172S probably damaging Het
Prr23a3 T A 9: 98,865,378 D128E possibly damaging Het
Prss28 A G 17: 25,309,737 Y51C probably damaging Het
Psmb1 A T 17: 15,476,189 M85K probably benign Het
Rae1 T A 2: 173,012,608 probably benign Het
Rasal1 A G 5: 120,678,676 D759G probably benign Het
Rcvrn G A 11: 67,695,420 G2R probably damaging Het
Robo3 C T 9: 37,423,344 A597T probably damaging Het
Rsf1 GCG GCGACGGCGCCG 7: 97,579,907 probably benign Homo
Sdcbp T A 4: 6,378,980 Y22* probably null Het
Sin3a T C 9: 57,118,076 F1069L probably damaging Het
Slitrk3 C T 3: 73,049,796 V548I possibly damaging Het
Tbc1d22a A G 15: 86,391,086 H403R probably damaging Het
Tbr1 G T 2: 61,805,249 probably null Het
Tiam2 T A 17: 3,505,710 D65E probably damaging Het
Tpcn2 A G 7: 145,260,096 S488P probably benign Het
Trav9-2 T C 14: 53,591,238 S22P probably damaging Het
Trim34a T A 7: 104,247,862 N44K probably benign Het
Unc79 C G 12: 103,112,432 P1619A probably benign Het
Usp22 A T 11: 61,157,216 V426E probably damaging Het
Vhl A T 6: 113,624,198 M20L unknown Het
Vmn1r215 G A 13: 23,075,894 A35T probably benign Het
Vmn1r222 G A 13: 23,232,432 L204F possibly damaging Het
Zfp871 A T 17: 32,775,855 H115Q probably damaging Het
Zpr1 T A 9: 46,278,342 F340L probably benign Het
Other mutations in Olfr1458
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01684:Olfr1458 APN 19 13102989 missense possibly damaging 0.93
IGL02319:Olfr1458 APN 19 13102662 missense probably benign 0.14
IGL02926:Olfr1458 APN 19 13102823 missense possibly damaging 0.74
IGL03107:Olfr1458 APN 19 13103037 missense probably benign
IGL03304:Olfr1458 APN 19 13102741 missense probably damaging 1.00
R0046:Olfr1458 UTSW 19 13103278 missense possibly damaging 0.76
R0049:Olfr1458 UTSW 19 13103278 missense possibly damaging 0.76
R0099:Olfr1458 UTSW 19 13103140 missense probably benign 0.07
R0103:Olfr1458 UTSW 19 13103278 missense possibly damaging 0.76
R0144:Olfr1458 UTSW 19 13103278 missense possibly damaging 0.76
R0189:Olfr1458 UTSW 19 13103278 missense possibly damaging 0.76
R0206:Olfr1458 UTSW 19 13103278 missense possibly damaging 0.76
R0207:Olfr1458 UTSW 19 13103278 missense possibly damaging 0.76
R0208:Olfr1458 UTSW 19 13103278 missense possibly damaging 0.76
R0212:Olfr1458 UTSW 19 13103278 missense possibly damaging 0.76
R0344:Olfr1458 UTSW 19 13103278 missense possibly damaging 0.76
R0426:Olfr1458 UTSW 19 13103278 missense possibly damaging 0.76
R0506:Olfr1458 UTSW 19 13103278 missense possibly damaging 0.76
R0507:Olfr1458 UTSW 19 13103278 missense possibly damaging 0.76
R0607:Olfr1458 UTSW 19 13103278 missense possibly damaging 0.76
R0661:Olfr1458 UTSW 19 13103278 missense possibly damaging 0.76
R0734:Olfr1458 UTSW 19 13103278 missense possibly damaging 0.76
R1347:Olfr1458 UTSW 19 13102690 missense probably benign 0.03
R1347:Olfr1458 UTSW 19 13102690 missense probably benign 0.03
R1443:Olfr1458 UTSW 19 13103204 nonsense probably null
R1446:Olfr1458 UTSW 19 13103016 missense possibly damaging 0.59
R1567:Olfr1458 UTSW 19 13102642 missense probably benign 0.00
R2190:Olfr1458 UTSW 19 13102493 missense probably damaging 1.00
R2438:Olfr1458 UTSW 19 13102421 missense probably benign 0.00
R4020:Olfr1458 UTSW 19 13102426 missense probably damaging 0.99
R4406:Olfr1458 UTSW 19 13102594 missense possibly damaging 0.70
R4631:Olfr1458 UTSW 19 13103272 missense probably benign 0.07
R4847:Olfr1458 UTSW 19 13102534 missense probably damaging 1.00
R6086:Olfr1458 UTSW 19 13102381 makesense probably null
R6480:Olfr1458 UTSW 19 13102474 missense probably benign 0.34
R6484:Olfr1458 UTSW 19 13103067 missense probably benign 0.34
R6786:Olfr1458 UTSW 19 13103203 missense probably benign 0.09
R7121:Olfr1458 UTSW 19 13103173 missense probably benign 0.03
X0024:Olfr1458 UTSW 19 13103209 missense probably benign 0.22
X0027:Olfr1458 UTSW 19 13103224 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- ATGGAATGACTGGACCTGGG -3'
(R):5'- CACCATGACAACACGTGTG -3'

Sequencing Primer
(F):5'- ACCTGGGCTGCAAGTACATG -3'
(R):5'- TGCGCATGTCTAGTCATTAGC -3'
Posted On2016-05-10