Incidental Mutation 'R4980:Cyp20a1'
ID384719
Institutional Source Beutler Lab
Gene Symbol Cyp20a1
Ensembl Gene ENSMUSG00000049439
Gene Namecytochrome P450, family 20, subfamily a, polypeptide 1
Synonyms
MMRRC Submission 042575-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4980 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location60343323-60388060 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 60363214 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 153 (W153R)
Ref Sequence ENSEMBL: ENSMUSP00000050823 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060608] [ENSMUST00000148443]
Predicted Effect probably damaging
Transcript: ENSMUST00000060608
AA Change: W153R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000050823
Gene: ENSMUSG00000049439
AA Change: W153R

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
Pfam:p450 40 456 1.5e-46 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000114202
SMART Domains Protein: ENSMUSP00000109840
Gene: ENSMUSG00000049439

DomainStartEndE-ValueType
transmembrane domain 4 23 N/A INTRINSIC
Pfam:p450 40 280 1.5e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148443
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases that catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein lacks one amino acid of the conserved heme binding site. It also lacks the conserved I-helix motif AGX(D,E)T, suggesting that its substrate may carry its own oxygen. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A T 5: 109,737,426 C189S probably damaging Het
4932438A13Rik T C 3: 36,943,312 S1173P probably damaging Het
9030624J02Rik T A 7: 118,807,009 D605E probably damaging Het
Abcd3 A T 3: 121,769,268 probably null Het
Adar T C 3: 89,730,814 S2P probably benign Het
Amhr2 T A 15: 102,454,330 S511T probably benign Het
Atg16l1 T C 1: 87,766,831 S77P possibly damaging Het
C530008M17Rik A T 5: 76,857,574 D594V unknown Het
Cacna1i T C 15: 80,348,449 F218L probably damaging Het
Cd5l A T 3: 87,367,601 H149L probably benign Het
Cdc14a T A 3: 116,392,857 R92* probably null Het
Col19a1 T C 1: 24,526,483 T256A unknown Het
Col22a1 C T 15: 71,801,943 A975T unknown Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Dpyd T C 3: 118,917,118 S392P probably damaging Het
Dst A T 1: 34,256,288 L957F probably damaging Het
Emilin2 G T 17: 71,253,071 D970E possibly damaging Het
Fam208a T A 14: 27,461,425 L614I probably benign Het
Fbn2 T C 18: 58,010,631 E2784G probably benign Het
Fbxw10 T C 11: 62,847,757 I159T possibly damaging Het
Fgfr2 T C 7: 130,201,080 Y192C probably damaging Het
Gm7298 A G 6: 121,759,239 probably null Het
Igf2r C T 17: 12,703,360 probably null Het
Ints4 T C 7: 97,501,850 probably null Het
Kcnf1 A G 12: 17,175,011 F403S possibly damaging Het
Kif11 C T 19: 37,387,371 Q211* probably null Het
Kif13a A G 13: 46,752,746 S574P possibly damaging Het
Kifc3 T A 8: 95,126,549 T60S probably benign Het
Krt82 T C 15: 101,545,099 D284G possibly damaging Het
Lancl1 T C 1: 67,004,809 Y344C probably benign Het
Ltbp3 A T 19: 5,753,927 probably null Het
Map3k4 A G 17: 12,272,071 F158L probably damaging Het
Mast2 A G 4: 116,317,751 Y469H probably damaging Het
Mcf2l T G 8: 12,984,883 F97C probably damaging Het
Mpeg1 T C 19: 12,461,540 S121P probably damaging Het
Mycbp2 A T 14: 103,260,385 probably null Het
Myt1l A T 12: 29,827,039 T230S unknown Het
Naa15 T C 3: 51,458,752 probably null Het
Nans G A 4: 46,492,764 R64Q probably benign Het
Nbea C T 3: 55,647,351 probably null Het
Nbea T C 3: 55,953,045 E1870G probably benign Het
Ncapd3 T C 9: 27,063,295 S688P probably damaging Het
Nedd4l G T 18: 65,080,060 E96* probably null Het
Olfr1444 A T 19: 12,862,020 M82L probably benign Het
Olfr683 T A 7: 105,144,224 Y23F probably benign Het
Pdxk A G 10: 78,451,484 L81P probably damaging Het
Plec T A 15: 76,193,295 R269* probably null Het
Plec T C 15: 76,205,865 I92V probably damaging Het
Ppara T C 15: 85,787,233 Y112H probably damaging Het
Ppp2r2c A T 5: 36,952,388 M364L probably benign Het
Prag1 A C 8: 36,139,586 H827P probably damaging Het
Ptprg A G 14: 12,154,421 N714S probably benign Het
Rbp2 G A 9: 98,498,841 V67I probably benign Het
Rictor T A 15: 6,781,660 Y835N probably damaging Het
Ripply2 A G 9: 87,019,694 Q91R probably damaging Het
Sap130 C A 18: 31,649,646 H203Q possibly damaging Het
Sema4d T C 13: 51,711,234 Y358C probably damaging Het
Serbp1 G A 6: 67,277,888 D294N probably benign Het
Slc16a10 A G 10: 40,080,805 W113R probably damaging Het
Slc6a6 A G 6: 91,726,060 Y138C probably damaging Het
Spag11a T C 8: 19,157,946 M1T probably null Het
Spata20 T C 11: 94,484,609 M120V probably damaging Het
Stk32a A C 18: 43,314,048 K357Q probably benign Het
Trmo A T 4: 46,389,364 C10* probably null Het
Tsc22d1 T G 14: 76,418,256 V643G probably benign Het
Vangl2 A T 1: 172,009,565 L226I probably damaging Het
Wnt3a A T 11: 59,249,800 C297S probably damaging Het
Wwc1 T C 11: 35,888,103 K301E possibly damaging Het
Zfhx4 C T 3: 5,398,979 T1399I possibly damaging Het
Zswim4 C T 8: 84,226,667 probably null Het
Other mutations in Cyp20a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02146:Cyp20a1 APN 1 60371251 missense possibly damaging 0.79
IGL02725:Cyp20a1 APN 1 60366706 missense probably benign 0.08
IGL03394:Cyp20a1 APN 1 60366681 missense probably damaging 0.99
R0003:Cyp20a1 UTSW 1 60387126 splice site probably benign
R0098:Cyp20a1 UTSW 1 60387254 nonsense probably null
R0098:Cyp20a1 UTSW 1 60387254 nonsense probably null
R0217:Cyp20a1 UTSW 1 60343466 splice site probably benign
R0491:Cyp20a1 UTSW 1 60371327 missense possibly damaging 0.71
R1543:Cyp20a1 UTSW 1 60376194 splice site probably benign
R4519:Cyp20a1 UTSW 1 60387147 missense probably damaging 1.00
R4621:Cyp20a1 UTSW 1 60376099 missense probably benign
R4930:Cyp20a1 UTSW 1 60366719 missense probably damaging 0.98
R5088:Cyp20a1 UTSW 1 60363350 missense probably damaging 0.99
R5356:Cyp20a1 UTSW 1 60379387 missense probably benign 0.08
R5545:Cyp20a1 UTSW 1 60376082 missense possibly damaging 0.71
R5897:Cyp20a1 UTSW 1 60353061 missense probably damaging 1.00
R5926:Cyp20a1 UTSW 1 60363242 missense possibly damaging 0.52
R6317:Cyp20a1 UTSW 1 60352124 missense probably damaging 1.00
R6320:Cyp20a1 UTSW 1 60352172 critical splice donor site probably null
R7471:Cyp20a1 UTSW 1 60354640 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGACGCTAAGGCCAAACCATTG -3'
(R):5'- ACACCCCTTCTTCAGAGGTAAAGTC -3'

Sequencing Primer
(F):5'- CCAAACCATTGAAGATTGAGGTTG -3'
(R):5'- CTGCTTGGCCTGATTAAAGAACTG -3'
Posted On2016-05-10