Incidental Mutation 'R4980:Atg16l1'
ID384721
Institutional Source Beutler Lab
Gene Symbol Atg16l1
Ensembl Gene ENSMUSG00000026289
Gene Nameautophagy related 16-like 1 (S. cerevisiae)
Synonyms1500009K01Rik, APG16L, WDR30
MMRRC Submission 042575-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4980 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location87755870-87792428 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87766831 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 77 (S77P)
Ref Sequence ENSEMBL: ENSMUSP00000120955 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027512] [ENSMUST00000113186] [ENSMUST00000113190] [ENSMUST00000144047]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027512
AA Change: S139P

PolyPhen 2 Score 0.889 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000027512
Gene: ENSMUSG00000026289
AA Change: S139P

DomainStartEndE-ValueType
Pfam:ATG16 13 207 1.3e-63 PFAM
low complexity region 237 246 N/A INTRINSIC
WD40 311 350 7.05e-9 SMART
WD40 355 394 7.28e-2 SMART
WD40 397 436 1.07e-8 SMART
WD40 439 475 3.7e0 SMART
WD40 478 516 5.35e-1 SMART
WD40 519 562 1.2e-2 SMART
WD40 565 605 6.89e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000113186
AA Change: S139P

PolyPhen 2 Score 0.889 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000108811
Gene: ENSMUSG00000026289
AA Change: S139P

DomainStartEndE-ValueType
Pfam:ATG16 13 207 3.7e-64 PFAM
low complexity region 237 246 N/A INTRINSIC
low complexity region 257 271 N/A INTRINSIC
WD40 292 331 7.05e-9 SMART
WD40 336 375 7.28e-2 SMART
WD40 378 417 1.07e-8 SMART
WD40 420 456 3.7e0 SMART
WD40 459 497 5.35e-1 SMART
WD40 500 543 1.2e-2 SMART
WD40 546 586 6.89e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000113190
AA Change: S139P

PolyPhen 2 Score 0.889 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000108815
Gene: ENSMUSG00000026289
AA Change: S139P

DomainStartEndE-ValueType
Pfam:ATG16 16 206 6.5e-49 PFAM
low complexity region 237 246 N/A INTRINSIC
low complexity region 295 306 N/A INTRINSIC
WD40 327 366 7.05e-9 SMART
WD40 371 410 7.28e-2 SMART
WD40 413 452 1.07e-8 SMART
WD40 455 491 3.7e0 SMART
WD40 494 532 5.35e-1 SMART
WD40 535 578 1.2e-2 SMART
WD40 581 621 6.89e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129431
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133072
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134603
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137638
Predicted Effect possibly damaging
Transcript: ENSMUST00000144047
AA Change: S77P

PolyPhen 2 Score 0.889 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000120955
Gene: ENSMUSG00000026289
AA Change: S77P

DomainStartEndE-ValueType
Pfam:ATG16 1 145 2.9e-50 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151037
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of a large protein complex that is necessary for autophagy, the major process by which intracellular components are targeted to lysosomes for degradation. Defects in this gene are a cause of susceptibility to inflammatory bowel disease type 10 (IBD10). Several transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jun 2010]
PHENOTYPE: Null homozygotes have a cellular defect in autophagy that results in lethality during the neonatal starvation period. Mice homozygous for hypomorphic alleles have Paneth cells with aberrant, disorganized granules similar to those found in patients with Crohn's disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A T 5: 109,737,426 C189S probably damaging Het
4932438A13Rik T C 3: 36,943,312 S1173P probably damaging Het
9030624J02Rik T A 7: 118,807,009 D605E probably damaging Het
Abcd3 A T 3: 121,769,268 probably null Het
Adar T C 3: 89,730,814 S2P probably benign Het
Amhr2 T A 15: 102,454,330 S511T probably benign Het
C530008M17Rik A T 5: 76,857,574 D594V unknown Het
Cacna1i T C 15: 80,348,449 F218L probably damaging Het
Cd5l A T 3: 87,367,601 H149L probably benign Het
Cdc14a T A 3: 116,392,857 R92* probably null Het
Col19a1 T C 1: 24,526,483 T256A unknown Het
Col22a1 C T 15: 71,801,943 A975T unknown Het
Cyp20a1 T C 1: 60,363,214 W153R probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Dpyd T C 3: 118,917,118 S392P probably damaging Het
Dst A T 1: 34,256,288 L957F probably damaging Het
Emilin2 G T 17: 71,253,071 D970E possibly damaging Het
Fam208a T A 14: 27,461,425 L614I probably benign Het
Fbn2 T C 18: 58,010,631 E2784G probably benign Het
Fbxw10 T C 11: 62,847,757 I159T possibly damaging Het
Fgfr2 T C 7: 130,201,080 Y192C probably damaging Het
Gm7298 A G 6: 121,759,239 probably null Het
Igf2r C T 17: 12,703,360 probably null Het
Ints4 T C 7: 97,501,850 probably null Het
Kcnf1 A G 12: 17,175,011 F403S possibly damaging Het
Kif11 C T 19: 37,387,371 Q211* probably null Het
Kif13a A G 13: 46,752,746 S574P possibly damaging Het
Kifc3 T A 8: 95,126,549 T60S probably benign Het
Krt82 T C 15: 101,545,099 D284G possibly damaging Het
Lancl1 T C 1: 67,004,809 Y344C probably benign Het
Ltbp3 A T 19: 5,753,927 probably null Het
Map3k4 A G 17: 12,272,071 F158L probably damaging Het
Mast2 A G 4: 116,317,751 Y469H probably damaging Het
Mcf2l T G 8: 12,984,883 F97C probably damaging Het
Mpeg1 T C 19: 12,461,540 S121P probably damaging Het
Mycbp2 A T 14: 103,260,385 probably null Het
Myt1l A T 12: 29,827,039 T230S unknown Het
Naa15 T C 3: 51,458,752 probably null Het
Nans G A 4: 46,492,764 R64Q probably benign Het
Nbea C T 3: 55,647,351 probably null Het
Nbea T C 3: 55,953,045 E1870G probably benign Het
Ncapd3 T C 9: 27,063,295 S688P probably damaging Het
Nedd4l G T 18: 65,080,060 E96* probably null Het
Olfr1444 A T 19: 12,862,020 M82L probably benign Het
Olfr683 T A 7: 105,144,224 Y23F probably benign Het
Pdxk A G 10: 78,451,484 L81P probably damaging Het
Plec T A 15: 76,193,295 R269* probably null Het
Plec T C 15: 76,205,865 I92V probably damaging Het
Ppara T C 15: 85,787,233 Y112H probably damaging Het
Ppp2r2c A T 5: 36,952,388 M364L probably benign Het
Prag1 A C 8: 36,139,586 H827P probably damaging Het
Ptprg A G 14: 12,154,421 N714S probably benign Het
Rbp2 G A 9: 98,498,841 V67I probably benign Het
Rictor T A 15: 6,781,660 Y835N probably damaging Het
Ripply2 A G 9: 87,019,694 Q91R probably damaging Het
Sap130 C A 18: 31,649,646 H203Q possibly damaging Het
Sema4d T C 13: 51,711,234 Y358C probably damaging Het
Serbp1 G A 6: 67,277,888 D294N probably benign Het
Slc16a10 A G 10: 40,080,805 W113R probably damaging Het
Slc6a6 A G 6: 91,726,060 Y138C probably damaging Het
Spag11a T C 8: 19,157,946 M1T probably null Het
Spata20 T C 11: 94,484,609 M120V probably damaging Het
Stk32a A C 18: 43,314,048 K357Q probably benign Het
Trmo A T 4: 46,389,364 C10* probably null Het
Tsc22d1 T G 14: 76,418,256 V643G probably benign Het
Vangl2 A T 1: 172,009,565 L226I probably damaging Het
Wnt3a A T 11: 59,249,800 C297S probably damaging Het
Wwc1 T C 11: 35,888,103 K301E possibly damaging Het
Zfhx4 C T 3: 5,398,979 T1399I possibly damaging Het
Zswim4 C T 8: 84,226,667 probably null Het
Other mutations in Atg16l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Atg16l1 APN 1 87765397 missense possibly damaging 0.68
IGL00861:Atg16l1 APN 1 87774838 missense probably damaging 1.00
IGL01065:Atg16l1 APN 1 87785931 missense probably damaging 0.99
IGL01068:Atg16l1 APN 1 87774824 missense probably damaging 1.00
IGL01140:Atg16l1 APN 1 87774853 missense probably benign 0.03
R0023:Atg16l1 UTSW 1 87789465 missense probably benign 0.00
R0023:Atg16l1 UTSW 1 87789465 missense probably benign 0.00
R0650:Atg16l1 UTSW 1 87781699 missense possibly damaging 0.93
R0655:Atg16l1 UTSW 1 87766829 missense probably damaging 1.00
R1421:Atg16l1 UTSW 1 87786358 splice site probably benign
R1549:Atg16l1 UTSW 1 87774188 missense probably benign
R2202:Atg16l1 UTSW 1 87767015 missense probably benign 0.03
R2204:Atg16l1 UTSW 1 87767015 missense probably benign 0.03
R3689:Atg16l1 UTSW 1 87785904 missense probably damaging 1.00
R4012:Atg16l1 UTSW 1 87766907 missense probably damaging 1.00
R4391:Atg16l1 UTSW 1 87760120 missense probably damaging 0.97
R4839:Atg16l1 UTSW 1 87766174 missense probably damaging 0.99
R4935:Atg16l1 UTSW 1 87767042 missense possibly damaging 0.69
R4990:Atg16l1 UTSW 1 87789369 missense probably benign 0.00
R5011:Atg16l1 UTSW 1 87774180 nonsense probably null
R5457:Atg16l1 UTSW 1 87775091 missense probably damaging 0.96
R5897:Atg16l1 UTSW 1 87785997 critical splice donor site probably null
R6289:Atg16l1 UTSW 1 87756215 missense probably damaging 0.99
R6437:Atg16l1 UTSW 1 87790648 missense probably damaging 1.00
R6727:Atg16l1 UTSW 1 87774854 missense possibly damaging 0.68
R6923:Atg16l1 UTSW 1 87774356 intron probably null
R7423:Atg16l1 UTSW 1 87786301 missense probably damaging 1.00
R7475:Atg16l1 UTSW 1 87760083 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TTACTAGCCGTCTGTGGTCG -3'
(R):5'- TCTGCATTGAGGCGATTGGC -3'

Sequencing Primer
(F):5'- TCGGTAGGCGCTTCATCCTG -3'
(R):5'- GGCTTCTTGGGCCTTCTCAG -3'
Posted On2016-05-10