Incidental Mutation 'R4980:Fbxw10'
ID384761
Institutional Source Beutler Lab
Gene Symbol Fbxw10
Ensembl Gene ENSMUSG00000090173
Gene NameF-box and WD-40 domain protein 10
SynonymsSM2SH2, SM25H2, Fbw10
MMRRC Submission 042575-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R4980 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location62847069-62877465 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 62847757 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 159 (I159T)
Ref Sequence ENSEMBL: ENSMUSP00000046156 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036085] [ENSMUST00000055006] [ENSMUST00000072639] [ENSMUST00000108703] [ENSMUST00000150989] [ENSMUST00000176577] [ENSMUST00000177336]
Predicted Effect possibly damaging
Transcript: ENSMUST00000036085
AA Change: I159T

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000046156
Gene: ENSMUSG00000090173
AA Change: I159T

DomainStartEndE-ValueType
low complexity region 262 274 N/A INTRINSIC
Blast:FBOX 286 326 6e-14 BLAST
Blast:WD40 416 453 2e-8 BLAST
WD40 457 496 1.78e-5 SMART
WD40 499 536 5.55e-7 SMART
WD40 539 575 2.84e-4 SMART
WD40 578 615 3.81e-5 SMART
WD40 620 656 6.9e-1 SMART
low complexity region 709 724 N/A INTRINSIC
coiled coil region 964 992 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000055006
SMART Domains Protein: ENSMUSP00000055542
Gene: ENSMUSG00000047821

DomainStartEndE-ValueType
Blast:BBOX 64 113 6e-24 BLAST
BBOX 117 157 3.24e-4 SMART
coiled coil region 171 196 N/A INTRINSIC
coiled coil region 237 265 N/A INTRINSIC
PRY 364 417 1.41e-22 SMART
SPRY 418 543 6.4e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000072639
SMART Domains Protein: ENSMUSP00000072432
Gene: ENSMUSG00000047821

DomainStartEndE-ValueType
Blast:BBOX 64 113 5e-24 BLAST
BBOX 117 157 3.24e-4 SMART
coiled coil region 171 196 N/A INTRINSIC
coiled coil region 237 265 N/A INTRINSIC
PRY 364 417 1.41e-22 SMART
Pfam:SPRY 418 483 1.4e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108703
SMART Domains Protein: ENSMUSP00000104343
Gene: ENSMUSG00000047821

DomainStartEndE-ValueType
Blast:BBOX 1 26 9e-10 BLAST
BBOX 30 70 3.24e-4 SMART
coiled coil region 84 109 N/A INTRINSIC
coiled coil region 150 178 N/A INTRINSIC
PRY 277 330 1.41e-22 SMART
SPRY 331 456 6.4e-27 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000150989
AA Change: I159T

PolyPhen 2 Score 0.871 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000117872
Gene: ENSMUSG00000090173
AA Change: I159T

DomainStartEndE-ValueType
low complexity region 262 274 N/A INTRINSIC
Blast:FBOX 286 326 1e-13 BLAST
Blast:WD40 406 443 2e-8 BLAST
WD40 447 486 1.78e-5 SMART
WD40 489 526 5.55e-7 SMART
WD40 529 565 2.84e-4 SMART
WD40 568 605 3.81e-5 SMART
WD40 610 646 6.9e-1 SMART
low complexity region 699 714 N/A INTRINSIC
coiled coil region 954 982 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175804
Predicted Effect probably benign
Transcript: ENSMUST00000176577
AA Change: I159T

PolyPhen 2 Score 0.332 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000135870
Gene: ENSMUSG00000090173
AA Change: I159T

DomainStartEndE-ValueType
low complexity region 262 274 N/A INTRINSIC
Blast:FBOX 286 326 6e-14 BLAST
Blast:WD40 406 443 2e-8 BLAST
WD40 447 486 1.78e-5 SMART
WD40 489 526 5.55e-7 SMART
WD40 529 565 2.84e-4 SMART
WD40 568 605 3.81e-5 SMART
WD40 610 646 6.9e-1 SMART
low complexity region 704 719 N/A INTRINSIC
coiled coil region 959 987 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000177336
AA Change: I159T

PolyPhen 2 Score 0.871 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000135294
Gene: ENSMUSG00000090173
AA Change: I159T

DomainStartEndE-ValueType
low complexity region 262 274 N/A INTRINSIC
Blast:FBOX 286 326 5e-14 BLAST
Blast:WD40 406 443 1e-8 BLAST
WD40 447 486 1.78e-5 SMART
WD40 489 526 5.55e-7 SMART
WD40 529 565 2.84e-4 SMART
WD40 568 605 3.81e-5 SMART
WD40 610 646 6.9e-1 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the F-box protein family, such as FBXW10, are characterized by an approximately 40-amino acid F-box motif. SCF complexes, formed by SKP1 (MIM 601434), cullin (see CUL1; MIM 603134), and F-box proteins, act as protein-ubiquitin ligases. F-box proteins interact with SKP1 through the F box, and they interact with ubiquitination targets through other protein interaction domains (Jin et al., 2004 [PubMed 15520277]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A T 5: 109,737,426 C189S probably damaging Het
4932438A13Rik T C 3: 36,943,312 S1173P probably damaging Het
9030624J02Rik T A 7: 118,807,009 D605E probably damaging Het
Abcd3 A T 3: 121,769,268 probably null Het
Adar T C 3: 89,730,814 S2P probably benign Het
Amhr2 T A 15: 102,454,330 S511T probably benign Het
Atg16l1 T C 1: 87,766,831 S77P possibly damaging Het
C530008M17Rik A T 5: 76,857,574 D594V unknown Het
Cacna1i T C 15: 80,348,449 F218L probably damaging Het
Cd5l A T 3: 87,367,601 H149L probably benign Het
Cdc14a T A 3: 116,392,857 R92* probably null Het
Col19a1 T C 1: 24,526,483 T256A unknown Het
Col22a1 C T 15: 71,801,943 A975T unknown Het
Cyp20a1 T C 1: 60,363,214 W153R probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Dpyd T C 3: 118,917,118 S392P probably damaging Het
Dst A T 1: 34,256,288 L957F probably damaging Het
Emilin2 G T 17: 71,253,071 D970E possibly damaging Het
Fam208a T A 14: 27,461,425 L614I probably benign Het
Fbn2 T C 18: 58,010,631 E2784G probably benign Het
Fgfr2 T C 7: 130,201,080 Y192C probably damaging Het
Gm7298 A G 6: 121,759,239 probably null Het
Igf2r C T 17: 12,703,360 probably null Het
Ints4 T C 7: 97,501,850 probably null Het
Kcnf1 A G 12: 17,175,011 F403S possibly damaging Het
Kif11 C T 19: 37,387,371 Q211* probably null Het
Kif13a A G 13: 46,752,746 S574P possibly damaging Het
Kifc3 T A 8: 95,126,549 T60S probably benign Het
Krt82 T C 15: 101,545,099 D284G possibly damaging Het
Lancl1 T C 1: 67,004,809 Y344C probably benign Het
Ltbp3 A T 19: 5,753,927 probably null Het
Map3k4 A G 17: 12,272,071 F158L probably damaging Het
Mast2 A G 4: 116,317,751 Y469H probably damaging Het
Mcf2l T G 8: 12,984,883 F97C probably damaging Het
Mpeg1 T C 19: 12,461,540 S121P probably damaging Het
Mycbp2 A T 14: 103,260,385 probably null Het
Myt1l A T 12: 29,827,039 T230S unknown Het
Naa15 T C 3: 51,458,752 probably null Het
Nans G A 4: 46,492,764 R64Q probably benign Het
Nbea C T 3: 55,647,351 probably null Het
Nbea T C 3: 55,953,045 E1870G probably benign Het
Ncapd3 T C 9: 27,063,295 S688P probably damaging Het
Nedd4l G T 18: 65,080,060 E96* probably null Het
Olfr1444 A T 19: 12,862,020 M82L probably benign Het
Olfr683 T A 7: 105,144,224 Y23F probably benign Het
Pdxk A G 10: 78,451,484 L81P probably damaging Het
Plec T A 15: 76,193,295 R269* probably null Het
Plec T C 15: 76,205,865 I92V probably damaging Het
Ppara T C 15: 85,787,233 Y112H probably damaging Het
Ppp2r2c A T 5: 36,952,388 M364L probably benign Het
Prag1 A C 8: 36,139,586 H827P probably damaging Het
Ptprg A G 14: 12,154,421 N714S probably benign Het
Rbp2 G A 9: 98,498,841 V67I probably benign Het
Rictor T A 15: 6,781,660 Y835N probably damaging Het
Ripply2 A G 9: 87,019,694 Q91R probably damaging Het
Sap130 C A 18: 31,649,646 H203Q possibly damaging Het
Sema4d T C 13: 51,711,234 Y358C probably damaging Het
Serbp1 G A 6: 67,277,888 D294N probably benign Het
Slc16a10 A G 10: 40,080,805 W113R probably damaging Het
Slc6a6 A G 6: 91,726,060 Y138C probably damaging Het
Spag11a T C 8: 19,157,946 M1T probably null Het
Spata20 T C 11: 94,484,609 M120V probably damaging Het
Stk32a A C 18: 43,314,048 K357Q probably benign Het
Trmo A T 4: 46,389,364 C10* probably null Het
Tsc22d1 T G 14: 76,418,256 V643G probably benign Het
Vangl2 A T 1: 172,009,565 L226I probably damaging Het
Wnt3a A T 11: 59,249,800 C297S probably damaging Het
Wwc1 T C 11: 35,888,103 K301E possibly damaging Het
Zfhx4 C T 3: 5,398,979 T1399I possibly damaging Het
Zswim4 C T 8: 84,226,667 probably null Het
Other mutations in Fbxw10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00941:Fbxw10 APN 11 62873501 missense probably damaging 1.00
IGL01552:Fbxw10 APN 11 62857684 critical splice acceptor site probably null
IGL01625:Fbxw10 APN 11 62860027 missense probably damaging 1.00
IGL01960:Fbxw10 APN 11 62876756 missense probably damaging 1.00
IGL02457:Fbxw10 APN 11 62874982 missense probably damaging 1.00
IGL02475:Fbxw10 APN 11 62857735 missense possibly damaging 0.94
IGL02864:Fbxw10 APN 11 62873523 missense probably damaging 1.00
R0083:Fbxw10 UTSW 11 62877061 missense probably benign 0.00
R0108:Fbxw10 UTSW 11 62877061 missense probably benign 0.00
R0147:Fbxw10 UTSW 11 62847481 unclassified probably null
R0180:Fbxw10 UTSW 11 62853096 missense probably benign 0.09
R0196:Fbxw10 UTSW 11 62877244 missense probably benign 0.01
R0454:Fbxw10 UTSW 11 62876738 missense possibly damaging 0.53
R0529:Fbxw10 UTSW 11 62859845 missense probably damaging 1.00
R0791:Fbxw10 UTSW 11 62847456 missense probably benign 0.18
R0927:Fbxw10 UTSW 11 62876944 missense probably damaging 0.98
R1026:Fbxw10 UTSW 11 62875171 missense probably benign
R1448:Fbxw10 UTSW 11 62847592 missense possibly damaging 0.74
R1468:Fbxw10 UTSW 11 62862638 missense probably damaging 1.00
R1468:Fbxw10 UTSW 11 62862638 missense probably damaging 1.00
R1689:Fbxw10 UTSW 11 62860036 missense probably damaging 1.00
R1785:Fbxw10 UTSW 11 62859857 missense probably damaging 0.99
R2130:Fbxw10 UTSW 11 62859857 missense probably damaging 0.99
R2132:Fbxw10 UTSW 11 62859857 missense probably damaging 0.99
R2211:Fbxw10 UTSW 11 62867535 missense probably damaging 0.99
R3078:Fbxw10 UTSW 11 62867513 splice site probably benign
R3700:Fbxw10 UTSW 11 62869157 splice site probably null
R3932:Fbxw10 UTSW 11 62869157 splice site probably benign
R4843:Fbxw10 UTSW 11 62847325 missense possibly damaging 0.95
R4869:Fbxw10 UTSW 11 62862731 missense probably damaging 0.98
R4879:Fbxw10 UTSW 11 62847747 missense probably damaging 0.99
R5417:Fbxw10 UTSW 11 62877164 missense possibly damaging 0.53
R5531:Fbxw10 UTSW 11 62862656 missense probably damaging 1.00
R5877:Fbxw10 UTSW 11 62857716 missense probably damaging 1.00
R6028:Fbxw10 UTSW 11 62873519 nonsense probably null
R6616:Fbxw10 UTSW 11 62853024 missense probably benign 0.14
R6870:Fbxw10 UTSW 11 62855367 missense probably damaging 0.99
R6967:Fbxw10 UTSW 11 62847603 missense possibly damaging 0.73
R7409:Fbxw10 UTSW 11 62876780 missense possibly damaging 0.86
R7464:Fbxw10 UTSW 11 62853298 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGTCTCGGATCAAACTCAGTAGG -3'
(R):5'- GCAGCTCCTCCTTTGGTAAG -3'

Sequencing Primer
(F):5'- CTCGGATCAAACTCAGTAGGAAGGG -3'
(R):5'- CAGCTCCTCCTTTGGTAAGTGATAG -3'
Posted On2016-05-10