Incidental Mutation 'R4980:Fam208a'
ID384768
Institutional Source Beutler Lab
Gene Symbol Fam208a
Ensembl Gene ENSMUSG00000040651
Gene Namefamily with sequence similarity 208, member A
SynonymsD14Abb1e, 4933409E02Rik
MMRRC Submission 042575-MU
Accession Numbers

Ensembl: ENSMUST00000059031; MGI: 1921694

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4980 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location27428834-27483555 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 27461425 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Isoleucine at position 614 (L614I)
Ref Sequence ENSEMBL: ENSMUSP00000022450 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022450]
Predicted Effect probably benign
Transcript: ENSMUST00000022450
AA Change: L614I

PolyPhen 2 Score 0.394 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000022450
Gene: ENSMUSG00000040651
AA Change: L614I

DomainStartEndE-ValueType
low complexity region 20 27 N/A INTRINSIC
low complexity region 42 61 N/A INTRINSIC
low complexity region 74 88 N/A INTRINSIC
Pfam:DUF3715 153 314 1.5e-55 PFAM
low complexity region 442 457 N/A INTRINSIC
low complexity region 1087 1102 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223688
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for ENU mutations are not viable past gastrulation. [provided by MGI curators]
Allele List at MGI

All alleles(26) : Gene trapped(26)

Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A T 5: 109,737,426 C189S probably damaging Het
4932438A13Rik T C 3: 36,943,312 S1173P probably damaging Het
9030624J02Rik T A 7: 118,807,009 D605E probably damaging Het
Abcd3 A T 3: 121,769,268 probably null Het
Adar T C 3: 89,730,814 S2P probably benign Het
Amhr2 T A 15: 102,454,330 S511T probably benign Het
Atg16l1 T C 1: 87,766,831 S77P possibly damaging Het
C530008M17Rik A T 5: 76,857,574 D594V unknown Het
Cacna1i T C 15: 80,348,449 F218L probably damaging Het
Cd5l A T 3: 87,367,601 H149L probably benign Het
Cdc14a T A 3: 116,392,857 R92* probably null Het
Col19a1 T C 1: 24,526,483 T256A unknown Het
Col22a1 C T 15: 71,801,943 A975T unknown Het
Cyp20a1 T C 1: 60,363,214 W153R probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Dpyd T C 3: 118,917,118 S392P probably damaging Het
Dst A T 1: 34,256,288 L957F probably damaging Het
Emilin2 G T 17: 71,253,071 D970E possibly damaging Het
Fbn2 T C 18: 58,010,631 E2784G probably benign Het
Fbxw10 T C 11: 62,847,757 I159T possibly damaging Het
Fgfr2 T C 7: 130,201,080 Y192C probably damaging Het
Gm7298 A G 6: 121,759,239 probably null Het
Igf2r C T 17: 12,703,360 probably null Het
Ints4 T C 7: 97,501,850 probably null Het
Kcnf1 A G 12: 17,175,011 F403S possibly damaging Het
Kif11 C T 19: 37,387,371 Q211* probably null Het
Kif13a A G 13: 46,752,746 S574P possibly damaging Het
Kifc3 T A 8: 95,126,549 T60S probably benign Het
Krt82 T C 15: 101,545,099 D284G possibly damaging Het
Lancl1 T C 1: 67,004,809 Y344C probably benign Het
Ltbp3 A T 19: 5,753,927 probably null Het
Map3k4 A G 17: 12,272,071 F158L probably damaging Het
Mast2 A G 4: 116,317,751 Y469H probably damaging Het
Mcf2l T G 8: 12,984,883 F97C probably damaging Het
Mpeg1 T C 19: 12,461,540 S121P probably damaging Het
Mycbp2 A T 14: 103,260,385 probably null Het
Myt1l A T 12: 29,827,039 T230S unknown Het
Naa15 T C 3: 51,458,752 probably null Het
Nans G A 4: 46,492,764 R64Q probably benign Het
Nbea C T 3: 55,647,351 probably null Het
Nbea T C 3: 55,953,045 E1870G probably benign Het
Ncapd3 T C 9: 27,063,295 S688P probably damaging Het
Nedd4l G T 18: 65,080,060 E96* probably null Het
Olfr1444 A T 19: 12,862,020 M82L probably benign Het
Olfr683 T A 7: 105,144,224 Y23F probably benign Het
Pdxk A G 10: 78,451,484 L81P probably damaging Het
Plec T A 15: 76,193,295 R269* probably null Het
Plec T C 15: 76,205,865 I92V probably damaging Het
Ppara T C 15: 85,787,233 Y112H probably damaging Het
Ppp2r2c A T 5: 36,952,388 M364L probably benign Het
Prag1 A C 8: 36,139,586 H827P probably damaging Het
Ptprg A G 14: 12,154,421 N714S probably benign Het
Rbp2 G A 9: 98,498,841 V67I probably benign Het
Rictor T A 15: 6,781,660 Y835N probably damaging Het
Ripply2 A G 9: 87,019,694 Q91R probably damaging Het
Sap130 C A 18: 31,649,646 H203Q possibly damaging Het
Sema4d T C 13: 51,711,234 Y358C probably damaging Het
Serbp1 G A 6: 67,277,888 D294N probably benign Het
Slc16a10 A G 10: 40,080,805 W113R probably damaging Het
Slc6a6 A G 6: 91,726,060 Y138C probably damaging Het
Spag11a T C 8: 19,157,946 M1T probably null Het
Spata20 T C 11: 94,484,609 M120V probably damaging Het
Stk32a A C 18: 43,314,048 K357Q probably benign Het
Trmo A T 4: 46,389,364 C10* probably null Het
Tsc22d1 T G 14: 76,418,256 V643G probably benign Het
Vangl2 A T 1: 172,009,565 L226I probably damaging Het
Wnt3a A T 11: 59,249,800 C297S probably damaging Het
Wwc1 T C 11: 35,888,103 K301E possibly damaging Het
Zfhx4 C T 3: 5,398,979 T1399I possibly damaging Het
Zswim4 C T 8: 84,226,667 probably null Het
Other mutations in Fam208a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Fam208a APN 14 27448206 missense probably damaging 1.00
IGL00467:Fam208a APN 14 27448164 missense probably benign 0.02
IGL01071:Fam208a APN 14 27442622 critical splice donor site probably null
IGL01351:Fam208a APN 14 27464301 missense probably benign 0.02
IGL01375:Fam208a APN 14 27440163 missense probably damaging 1.00
IGL01509:Fam208a APN 14 27459774 splice site probably benign
IGL02342:Fam208a APN 14 27476667 missense possibly damaging 0.83
IGL03105:Fam208a APN 14 27442552 missense probably damaging 0.98
IGL03131:Fam208a APN 14 27461179 nonsense probably null
IGL03248:Fam208a APN 14 27476692 missense probably damaging 1.00
IGL03383:Fam208a APN 14 27441961 missense possibly damaging 0.93
santa_rosa UTSW 14 27476701 splice site probably null
D4043:Fam208a UTSW 14 27471992 missense probably benign 0.07
R0147:Fam208a UTSW 14 27471768 missense probably benign 0.23
R0512:Fam208a UTSW 14 27446406 missense probably damaging 1.00
R0589:Fam208a UTSW 14 27461150 missense probably benign 0.01
R0609:Fam208a UTSW 14 27461750 missense probably benign 0.09
R0798:Fam208a UTSW 14 27476636 missense probably damaging 1.00
R1107:Fam208a UTSW 14 27479723 nonsense probably null
R1205:Fam208a UTSW 14 27461318 missense probably damaging 1.00
R1376:Fam208a UTSW 14 27429381 missense probably benign 0.00
R1376:Fam208a UTSW 14 27429381 missense probably benign 0.00
R1441:Fam208a UTSW 14 27464260 nonsense probably null
R1493:Fam208a UTSW 14 27449969 missense probably damaging 1.00
R1527:Fam208a UTSW 14 27480093 critical splice donor site probably null
R1729:Fam208a UTSW 14 27479633 missense probably damaging 1.00
R1752:Fam208a UTSW 14 27471928 nonsense probably null
R1960:Fam208a UTSW 14 27438664 missense probably damaging 1.00
R1960:Fam208a UTSW 14 27479789 missense possibly damaging 0.95
R1965:Fam208a UTSW 14 27442554 missense probably damaging 1.00
R2074:Fam208a UTSW 14 27461213 missense probably benign 0.03
R2107:Fam208a UTSW 14 27461787 critical splice donor site probably null
R2130:Fam208a UTSW 14 27446388 missense probably damaging 1.00
R2130:Fam208a UTSW 14 27476614 missense possibly damaging 0.74
R2131:Fam208a UTSW 14 27476614 missense possibly damaging 0.74
R2133:Fam208a UTSW 14 27476614 missense possibly damaging 0.74
R2140:Fam208a UTSW 14 27480035 missense probably damaging 1.00
R2184:Fam208a UTSW 14 27466184 missense possibly damaging 0.83
R2279:Fam208a UTSW 14 27442495 missense probably damaging 1.00
R3979:Fam208a UTSW 14 27477130 missense possibly damaging 0.95
R4113:Fam208a UTSW 14 27459961 nonsense probably null
R4434:Fam208a UTSW 14 27449861 critical splice donor site probably null
R4562:Fam208a UTSW 14 27466308 missense possibly damaging 0.67
R4568:Fam208a UTSW 14 27476701 splice site probably null
R4754:Fam208a UTSW 14 27461095 missense probably benign
R4993:Fam208a UTSW 14 27429114 missense possibly damaging 0.88
R5200:Fam208a UTSW 14 27429226 missense probably benign 0.41
R5316:Fam208a UTSW 14 27472035 missense possibly damaging 0.52
R5599:Fam208a UTSW 14 27479929 missense probably benign 0.01
R5678:Fam208a UTSW 14 27429123 small insertion probably benign
R5680:Fam208a UTSW 14 27429123 small insertion probably benign
R5887:Fam208a UTSW 14 27466297 nonsense probably null
R6181:Fam208a UTSW 14 27472278 missense probably benign 0.01
R6556:Fam208a UTSW 14 27429258 missense probably benign
R6603:Fam208a UTSW 14 27446386 missense probably damaging 1.00
R6829:Fam208a UTSW 14 27442481 missense possibly damaging 0.90
R6864:Fam208a UTSW 14 27461158 missense probably damaging 0.96
R6919:Fam208a UTSW 14 27449801 nonsense probably null
X0002:Fam208a UTSW 14 27472106 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TGGAGAAGCCTGAGAACTTAGC -3'
(R):5'- CCAAAGAATGAGACGACTTCTG -3'

Sequencing Primer
(F):5'- ACAGTTTTCTCTGATTCAATG -3'
(R):5'- AGAATGAGACGACTTCTGCTGTTCAG -3'
Posted On2016-05-10