Incidental Mutation 'R4980:Rictor'
ID384770
Institutional Source Beutler Lab
Gene Symbol Rictor
Ensembl Gene ENSMUSG00000050310
Gene NameRPTOR independent companion of MTOR, complex 2
SynonymsD530039E11Rik, 4921505C17Rik, 6030405M08Rik
MMRRC Submission 042575-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4980 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location6708379-6800401 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 6781660 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 835 (Y835N)
Ref Sequence ENSEMBL: ENSMUSP00000051809 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061656]
Predicted Effect probably damaging
Transcript: ENSMUST00000061656
AA Change: Y835N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000051809
Gene: ENSMUSG00000050310
AA Change: Y835N

DomainStartEndE-ValueType
RICTOR_N 57 439 4.02e-185 SMART
RICTOR_M 523 742 5.66e-98 SMART
RasGEF_N_2 743 857 1.26e-54 SMART
RICTOR_V 920 992 1.44e-40 SMART
low complexity region 1019 1043 N/A INTRINSIC
RICTOR_phospho 1084 1189 4.06e-58 SMART
low complexity region 1221 1239 N/A INTRINSIC
low complexity region 1255 1266 N/A INTRINSIC
low complexity region 1273 1287 N/A INTRINSIC
low complexity region 1404 1414 N/A INTRINSIC
low complexity region 1464 1474 N/A INTRINSIC
low complexity region 1616 1628 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228266
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RICTOR and MTOR (FRAP1; MIM 601231) are components of a protein complex that integrates nutrient- and growth factor-derived signals to regulate cell growth (Sarbassov et al., 2004 [PubMed 15268862]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality during organogenesis associated with abnormal placental morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A T 5: 109,737,426 C189S probably damaging Het
4932438A13Rik T C 3: 36,943,312 S1173P probably damaging Het
9030624J02Rik T A 7: 118,807,009 D605E probably damaging Het
Abcd3 A T 3: 121,769,268 probably null Het
Adar T C 3: 89,730,814 S2P probably benign Het
Amhr2 T A 15: 102,454,330 S511T probably benign Het
Atg16l1 T C 1: 87,766,831 S77P possibly damaging Het
C530008M17Rik A T 5: 76,857,574 D594V unknown Het
Cacna1i T C 15: 80,348,449 F218L probably damaging Het
Cd5l A T 3: 87,367,601 H149L probably benign Het
Cdc14a T A 3: 116,392,857 R92* probably null Het
Col19a1 T C 1: 24,526,483 T256A unknown Het
Col22a1 C T 15: 71,801,943 A975T unknown Het
Cyp20a1 T C 1: 60,363,214 W153R probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Dpyd T C 3: 118,917,118 S392P probably damaging Het
Dst A T 1: 34,256,288 L957F probably damaging Het
Emilin2 G T 17: 71,253,071 D970E possibly damaging Het
Fam208a T A 14: 27,461,425 L614I probably benign Het
Fbn2 T C 18: 58,010,631 E2784G probably benign Het
Fbxw10 T C 11: 62,847,757 I159T possibly damaging Het
Fgfr2 T C 7: 130,201,080 Y192C probably damaging Het
Gm7298 A G 6: 121,759,239 probably null Het
Igf2r C T 17: 12,703,360 probably null Het
Ints4 T C 7: 97,501,850 probably null Het
Kcnf1 A G 12: 17,175,011 F403S possibly damaging Het
Kif11 C T 19: 37,387,371 Q211* probably null Het
Kif13a A G 13: 46,752,746 S574P possibly damaging Het
Kifc3 T A 8: 95,126,549 T60S probably benign Het
Krt82 T C 15: 101,545,099 D284G possibly damaging Het
Lancl1 T C 1: 67,004,809 Y344C probably benign Het
Ltbp3 A T 19: 5,753,927 probably null Het
Map3k4 A G 17: 12,272,071 F158L probably damaging Het
Mast2 A G 4: 116,317,751 Y469H probably damaging Het
Mcf2l T G 8: 12,984,883 F97C probably damaging Het
Mpeg1 T C 19: 12,461,540 S121P probably damaging Het
Mycbp2 A T 14: 103,260,385 probably null Het
Myt1l A T 12: 29,827,039 T230S unknown Het
Naa15 T C 3: 51,458,752 probably null Het
Nans G A 4: 46,492,764 R64Q probably benign Het
Nbea C T 3: 55,647,351 probably null Het
Nbea T C 3: 55,953,045 E1870G probably benign Het
Ncapd3 T C 9: 27,063,295 S688P probably damaging Het
Nedd4l G T 18: 65,080,060 E96* probably null Het
Olfr1444 A T 19: 12,862,020 M82L probably benign Het
Olfr683 T A 7: 105,144,224 Y23F probably benign Het
Pdxk A G 10: 78,451,484 L81P probably damaging Het
Plec T A 15: 76,193,295 R269* probably null Het
Plec T C 15: 76,205,865 I92V probably damaging Het
Ppara T C 15: 85,787,233 Y112H probably damaging Het
Ppp2r2c A T 5: 36,952,388 M364L probably benign Het
Prag1 A C 8: 36,139,586 H827P probably damaging Het
Ptprg A G 14: 12,154,421 N714S probably benign Het
Rbp2 G A 9: 98,498,841 V67I probably benign Het
Ripply2 A G 9: 87,019,694 Q91R probably damaging Het
Sap130 C A 18: 31,649,646 H203Q possibly damaging Het
Sema4d T C 13: 51,711,234 Y358C probably damaging Het
Serbp1 G A 6: 67,277,888 D294N probably benign Het
Slc16a10 A G 10: 40,080,805 W113R probably damaging Het
Slc6a6 A G 6: 91,726,060 Y138C probably damaging Het
Spag11a T C 8: 19,157,946 M1T probably null Het
Spata20 T C 11: 94,484,609 M120V probably damaging Het
Stk32a A C 18: 43,314,048 K357Q probably benign Het
Trmo A T 4: 46,389,364 C10* probably null Het
Tsc22d1 T G 14: 76,418,256 V643G probably benign Het
Vangl2 A T 1: 172,009,565 L226I probably damaging Het
Wnt3a A T 11: 59,249,800 C297S probably damaging Het
Wwc1 T C 11: 35,888,103 K301E possibly damaging Het
Zfhx4 C T 3: 5,398,979 T1399I possibly damaging Het
Zswim4 C T 8: 84,226,667 probably null Het
Other mutations in Rictor
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00488:Rictor APN 15 6786590 missense probably damaging 0.99
IGL00785:Rictor APN 15 6776950 missense probably damaging 1.00
IGL00801:Rictor APN 15 6794534 missense probably damaging 1.00
IGL01072:Rictor APN 15 6789562 missense probably damaging 0.98
IGL01139:Rictor APN 15 6778268 missense probably damaging 1.00
IGL01303:Rictor APN 15 6708638 missense probably benign 0.10
IGL01307:Rictor APN 15 6774604 splice site probably null
IGL01767:Rictor APN 15 6777384 missense probably damaging 1.00
IGL01774:Rictor APN 15 6769777 missense probably damaging 1.00
IGL01800:Rictor APN 15 6774701 missense probably damaging 0.99
IGL02192:Rictor APN 15 6786414 missense probably benign 0.00
IGL02503:Rictor APN 15 6786443 missense probably benign 0.06
IGL02652:Rictor APN 15 6776187 critical splice donor site probably null
IGL02656:Rictor APN 15 6776920 missense probably damaging 0.98
IGL02752:Rictor APN 15 6787371 missense probably benign 0.02
IGL03000:Rictor APN 15 6769240 splice site probably benign
IGL03118:Rictor APN 15 6759518 missense possibly damaging 0.93
IGL03182:Rictor APN 15 6789598 missense probably benign 0.08
R0149:Rictor UTSW 15 6784107 missense possibly damaging 0.76
R0288:Rictor UTSW 15 6786540 missense probably benign 0.08
R0304:Rictor UTSW 15 6786371 splice site probably null
R0336:Rictor UTSW 15 6776753 critical splice acceptor site probably null
R0361:Rictor UTSW 15 6784107 missense possibly damaging 0.76
R0423:Rictor UTSW 15 6773900 missense possibly damaging 0.77
R0453:Rictor UTSW 15 6708642 missense probably benign 0.01
R0515:Rictor UTSW 15 6769301 missense probably damaging 1.00
R0630:Rictor UTSW 15 6794492 missense probably damaging 1.00
R0730:Rictor UTSW 15 6773986 splice site probably benign
R0744:Rictor UTSW 15 6764278 critical splice acceptor site probably null
R0836:Rictor UTSW 15 6764278 critical splice acceptor site probably null
R0881:Rictor UTSW 15 6791670 missense probably benign
R1114:Rictor UTSW 15 6794005 nonsense probably null
R1367:Rictor UTSW 15 6790638 splice site probably benign
R1655:Rictor UTSW 15 6772212 missense probably benign 0.00
R1678:Rictor UTSW 15 6756471 missense probably benign 0.07
R1679:Rictor UTSW 15 6768090 missense possibly damaging 0.92
R1754:Rictor UTSW 15 6735368 missense probably damaging 1.00
R1757:Rictor UTSW 15 6773862 missense possibly damaging 0.95
R1762:Rictor UTSW 15 6756573 missense probably benign 0.00
R1914:Rictor UTSW 15 6759572 missense probably damaging 1.00
R1915:Rictor UTSW 15 6759572 missense probably damaging 1.00
R1994:Rictor UTSW 15 6776156 missense probably benign 0.18
R2145:Rictor UTSW 15 6765107 missense probably damaging 1.00
R2182:Rictor UTSW 15 6772204 missense probably damaging 0.96
R2191:Rictor UTSW 15 6759614 missense probably benign 0.04
R2357:Rictor UTSW 15 6783562 missense probably damaging 0.99
R2914:Rictor UTSW 15 6769995 critical splice donor site probably null
R3082:Rictor UTSW 15 6774857 missense probably benign 0.15
R3885:Rictor UTSW 15 6759610 missense probably damaging 1.00
R3900:Rictor UTSW 15 6789473 missense probably benign 0.01
R4376:Rictor UTSW 15 6786967 missense probably benign 0.00
R4611:Rictor UTSW 15 6787144 missense possibly damaging 0.75
R4644:Rictor UTSW 15 6777935 nonsense probably null
R4718:Rictor UTSW 15 6783160 missense possibly damaging 0.81
R4822:Rictor UTSW 15 6791680 missense probably benign 0.01
R5034:Rictor UTSW 15 6768095 missense probably damaging 0.98
R5179:Rictor UTSW 15 6795940 missense probably damaging 1.00
R5386:Rictor UTSW 15 6789504 missense probably benign 0.37
R5532:Rictor UTSW 15 6789565 missense probably damaging 1.00
R5549:Rictor UTSW 15 6786910 missense probably damaging 1.00
R5715:Rictor UTSW 15 6750716 nonsense probably null
R5733:Rictor UTSW 15 6783104 missense probably benign
R5822:Rictor UTSW 15 6794006 missense probably benign 0.00
R5848:Rictor UTSW 15 6794006 missense probably benign 0.00
R5849:Rictor UTSW 15 6794006 missense probably benign 0.00
R5850:Rictor UTSW 15 6794006 missense probably benign 0.00
R5854:Rictor UTSW 15 6794006 missense probably benign 0.00
R5855:Rictor UTSW 15 6794006 missense probably benign 0.00
R5856:Rictor UTSW 15 6794006 missense probably benign 0.00
R5936:Rictor UTSW 15 6784161 missense probably damaging 0.99
R6155:Rictor UTSW 15 6793977 missense probably benign 0.44
R6394:Rictor UTSW 15 6769309 missense possibly damaging 0.59
R6549:Rictor UTSW 15 6796175 missense probably damaging 1.00
R6611:Rictor UTSW 15 6750659 missense probably damaging 1.00
R6657:Rictor UTSW 15 6759496 missense possibly damaging 0.94
R6705:Rictor UTSW 15 6794012 missense probably benign 0.00
R6819:Rictor UTSW 15 6796036 critical splice donor site probably null
R6985:Rictor UTSW 15 6772154 missense probably benign 0.27
R6989:Rictor UTSW 15 6772154 missense probably benign 0.27
R7016:Rictor UTSW 15 6774880 critical splice donor site probably null
R7030:Rictor UTSW 15 6708453 critical splice donor site probably null
R7066:Rictor UTSW 15 6772154 missense probably benign 0.27
R7067:Rictor UTSW 15 6772154 missense probably benign 0.27
R7216:Rictor UTSW 15 6769301 missense probably damaging 1.00
R7396:Rictor UTSW 15 6786981 missense not run
X0020:Rictor UTSW 15 6756482 missense probably benign 0.32
X0060:Rictor UTSW 15 6786552 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GGACAGAGGCCATTACTTGCTC -3'
(R):5'- GAACAGGAGTCCTCGGAAAC -3'

Sequencing Primer
(F):5'- CTTGCTCATTTACATGGAAGGAGAG -3'
(R):5'- TACTGCGACGAACGTAGT -3'
Posted On2016-05-10