Incidental Mutation 'R4981:Lmtk2'
ID384816
Institutional Source Beutler Lab
Gene Symbol Lmtk2
Ensembl Gene ENSMUSG00000038970
Gene Namelemur tyrosine kinase 2
SynonymsAATYK2, A330101P12Rik, KPI2, cprk, KPI-2, 2900041G10Rik, BREK
MMRRC Submission 042576-MU
Accession Numbers

Genbank: NM_001081109; MGI: 3036247

Is this an essential gene? Possibly non essential (E-score: 0.303) question?
Stock #R4981 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location144100436-144188204 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 144176447 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 1328 (F1328L)
Ref Sequence ENSEMBL: ENSMUSP00000048238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041804]
Predicted Effect probably damaging
Transcript: ENSMUST00000041804
AA Change: F1328L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000048238
Gene: ENSMUSG00000038970
AA Change: F1328L

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
transmembrane domain 42 61 N/A INTRINSIC
low complexity region 72 88 N/A INTRINSIC
STYKc 136 406 3.4e-39 SMART
low complexity region 924 953 N/A INTRINSIC
low complexity region 1019 1035 N/A INTRINSIC
low complexity region 1104 1117 N/A INTRINSIC
low complexity region 1168 1180 N/A INTRINSIC
low complexity region 1252 1266 N/A INTRINSIC
low complexity region 1354 1367 N/A INTRINSIC
low complexity region 1380 1392 N/A INTRINSIC
Meta Mutation Damage Score 0.254 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.3%
Validation Efficiency 100% (105/105)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the protein kinase superfamily and the protein tyrosine kinase family. It contains N-terminal transmembrane helices and a long C-terminal cytoplasmic tail with serine/threonine/tyrosine kinase activity. This protein interacts with several other proteins, such as Inhibitor-2 (Inh2), protein phosphatase-1 (PP1C), p35, and myosin VI. It phosporylates other proteins, and is itself also phosporylated when interacting with cyclin-dependent kinase 5 (cdk5)/p35 complex. This protein involves in nerve growth factor (NGF)-TrkA signalling, and also plays a critical role in endosomal membrane trafficking. Mouse studies suggested an essential role of this protein in spermatogenesis. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a null mutation in this gene display partial prenatal lethality, male infertility, and azoospermia. [provided by MGI curators]
Allele List at MGI

All alleles(31) : Targeted, knock-out(1) Gene trapped(30)

Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700097O09Rik A T 12: 55,048,987 probably null Het
Aatf T C 11: 84,511,497 D121G probably benign Het
Amer2 T A 14: 60,379,727 L331H probably damaging Het
Ang4 T G 14: 51,764,372 K40Q probably benign Het
Aspm A C 1: 139,470,760 probably null Het
Cacna1c A T 6: 118,751,471 D337E probably benign Het
Ccdc124 T C 8: 70,868,785 E134G probably benign Het
Ccdc7a G T 8: 128,984,983 A312E probably benign Het
Ccdc84 A T 9: 44,417,948 F14Y probably damaging Het
Cd209g A G 8: 4,136,845 D130G probably damaging Het
Cd320 T C 17: 33,847,575 S96P probably benign Het
Clu C G 14: 65,973,366 Q134E probably damaging Het
Cnksr3 T A 10: 7,160,777 H28L probably benign Het
Cntnap1 T C 11: 101,176,333 probably null Het
Col22a1 C T 15: 71,861,066 C546Y unknown Het
Col6a3 C T 1: 90,778,843 V2183I unknown Het
Cop1 A G 1: 159,325,068 probably benign Het
Cpne8 T C 15: 90,679,235 I24V probably benign Het
Cspp1 T A 1: 10,126,463 N900K probably damaging Het
Dennd5b G A 6: 149,009,772 L978F possibly damaging Het
Depdc1a G T 3: 159,523,913 M627I probably benign Het
Dnah3 A T 7: 119,956,201 N2721K probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Dsg1b A G 18: 20,408,868 T811A possibly damaging Het
Emilin1 C G 5: 30,919,351 Q847E probably benign Het
Epha3 A T 16: 63,652,412 V370D probably benign Het
Epha5 T A 5: 84,150,483 T406S probably damaging Het
Ephb1 A T 9: 102,040,960 I450N probably benign Het
Ephb2 A G 4: 136,696,010 M319T probably benign Het
Eps15l1 A G 8: 72,378,989 probably null Het
Fbxo9 G A 9: 78,085,886 probably benign Het
Fgd5 T C 6: 91,989,300 I838T probably damaging Het
Fnbp4 T C 2: 90,765,830 F582L probably damaging Het
Frs3 T C 17: 47,689,262 probably null Het
Fscb C T 12: 64,473,619 V358I possibly damaging Het
Fus G T 7: 127,967,555 probably benign Het
Fyb CCTCTCTCTCTCTCTCTCTCT CCTCTCTCTCTCTCTCTCT 15: 6,646,611 probably benign Het
Glra3 A T 8: 55,991,235 I77F possibly damaging Het
Gm4454 C T 7: 38,570,436 noncoding transcript Het
Gng3 G A 19: 8,838,261 A37V possibly damaging Het
Grin3b T A 10: 79,976,357 probably benign Het
Herpud1 A G 8: 94,391,794 Y41C probably damaging Het
Igkv4-92 G C 6: 68,755,044 S115R possibly damaging Het
Ikbip T A 10: 91,095,986 I164N probably benign Het
Kank1 A G 19: 25,411,395 T783A probably benign Het
Kcnq3 A T 15: 66,031,405 V152E possibly damaging Het
Kif23 C T 9: 61,931,871 R314H probably damaging Het
Klc4 T C 17: 46,644,361 H49R probably benign Het
Klhl20 A T 1: 161,103,005 I309N possibly damaging Het
Lgals4 A G 7: 28,841,276 Y268C probably damaging Het
Lingo4 A G 3: 94,399,454 Q13R probably benign Het
Mapk14 A G 17: 28,741,791 R179G probably damaging Het
Mbd3l1 A T 9: 18,484,905 T109S probably benign Het
Megf6 T C 4: 154,267,450 F1169L possibly damaging Het
Mrgpra1 A T 7: 47,335,211 V240D probably damaging Het
Muc6 G A 7: 141,638,400 S2120F possibly damaging Het
Myh1 T C 11: 67,224,474 probably benign Het
Nav3 T C 10: 109,880,692 I172V probably benign Het
Nemp1 T A 10: 127,693,530 L178Q probably damaging Het
Numa1 T C 7: 101,992,674 S110P probably damaging Het
Olfr1076 T C 2: 86,508,827 Y123H probably damaging Het
Olfr1222 T C 2: 89,125,501 T77A probably benign Het
Olfr1248 A G 2: 89,617,425 Y256H probably damaging Het
Olfr1500 A T 19: 13,828,094 F101I probably damaging Het
Olfr639 A G 7: 104,012,105 I199T probably damaging Het
Olfr995 A G 2: 85,438,469 S230P probably damaging Het
Pard3b T G 1: 62,344,060 M771R probably damaging Het
Phkg2 A G 7: 127,582,379 I245V probably damaging Het
Pik3cg A T 12: 32,204,104 M628K possibly damaging Het
Poln A G 5: 34,107,085 probably null Het
Ppip5k1 A T 2: 121,312,390 S1172T probably damaging Het
Prdm5 A T 6: 65,870,462 H363L probably damaging Het
Prkdc A G 16: 15,678,309 Y788C probably damaging Het
Prrc2c T A 1: 162,692,547 R2076S probably damaging Het
Sh2d2a A G 3: 87,849,421 Y191C probably damaging Het
Slc20a1 T C 2: 129,199,999 I94T probably damaging Het
Sptbn2 T C 19: 4,751,658 V2366A probably benign Het
Stab2 T A 10: 86,960,223 M387L probably benign Het
Syne2 T G 12: 75,941,219 M1718R probably damaging Het
Synm G T 7: 67,734,487 F700L probably benign Het
Tmco4 T C 4: 138,990,701 F51L possibly damaging Het
Tmem104 C A 11: 115,205,136 P168T probably damaging Het
Tril G T 6: 53,818,920 T439K probably benign Het
Trim2 A G 3: 84,177,735 L559P probably damaging Het
Trim3 A G 7: 105,619,128 V149A probably damaging Het
Triml2 A G 8: 43,187,680 N191S probably benign Het
Usp4 A G 9: 108,381,418 D16G probably benign Het
Vmn2r58 G A 7: 41,837,461 T670I probably damaging Het
Vmn2r97 G T 17: 18,940,174 G524* probably null Het
Xpo5 C A 17: 46,220,817 F426L probably damaging Het
Zfp800 A G 6: 28,247,191 L84S probably damaging Het
Zranb2 T G 3: 157,546,741 probably benign Het
Zswim4 C T 8: 84,226,667 probably null Het
Other mutations in Lmtk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Lmtk2 APN 5 144134155 missense probably damaging 1.00
IGL00496:Lmtk2 APN 5 144174694 missense probably benign
IGL00848:Lmtk2 APN 5 144176398 missense probably benign
IGL01450:Lmtk2 APN 5 144174702 missense probably benign 0.03
IGL01833:Lmtk2 APN 5 144175935 nonsense probably null
IGL01967:Lmtk2 APN 5 144182779 missense probably benign
IGL01998:Lmtk2 APN 5 144176065 missense probably damaging 1.00
IGL02106:Lmtk2 APN 5 144175951 missense probably benign 0.03
IGL02147:Lmtk2 APN 5 144156936 missense possibly damaging 0.78
IGL02581:Lmtk2 APN 5 144148348 missense probably damaging 1.00
A4554:Lmtk2 UTSW 5 144166317 missense possibly damaging 0.82
R0039:Lmtk2 UTSW 5 144166387 missense probably damaging 1.00
R0039:Lmtk2 UTSW 5 144166387 missense probably damaging 1.00
R0108:Lmtk2 UTSW 5 144174285 missense possibly damaging 0.78
R0367:Lmtk2 UTSW 5 144174285 missense possibly damaging 0.78
R0515:Lmtk2 UTSW 5 144174991 missense possibly damaging 0.77
R1434:Lmtk2 UTSW 5 144174589 missense probably damaging 1.00
R1617:Lmtk2 UTSW 5 144173862 missense probably damaging 1.00
R1760:Lmtk2 UTSW 5 144174175 missense probably damaging 0.99
R1785:Lmtk2 UTSW 5 144174988 missense possibly damaging 0.61
R1786:Lmtk2 UTSW 5 144174988 missense possibly damaging 0.61
R1907:Lmtk2 UTSW 5 144175110 missense probably benign 0.00
R2130:Lmtk2 UTSW 5 144174988 missense possibly damaging 0.61
R2131:Lmtk2 UTSW 5 144174988 missense possibly damaging 0.61
R2132:Lmtk2 UTSW 5 144174988 missense possibly damaging 0.61
R2133:Lmtk2 UTSW 5 144174988 missense possibly damaging 0.61
R2140:Lmtk2 UTSW 5 144147615 missense probably damaging 1.00
R2141:Lmtk2 UTSW 5 144147615 missense probably damaging 1.00
R2210:Lmtk2 UTSW 5 144147609 missense probably damaging 1.00
R2289:Lmtk2 UTSW 5 144176106 missense possibly damaging 0.80
R2312:Lmtk2 UTSW 5 144173626 missense probably damaging 1.00
R2352:Lmtk2 UTSW 5 144173911 missense probably benign 0.05
R3870:Lmtk2 UTSW 5 144166427 splice site probably benign
R4011:Lmtk2 UTSW 5 144175879 missense probably benign 0.01
R4272:Lmtk2 UTSW 5 144183226 missense probably benign 0.05
R4361:Lmtk2 UTSW 5 144147664 missense probably damaging 1.00
R4580:Lmtk2 UTSW 5 144174781 missense possibly damaging 0.56
R4621:Lmtk2 UTSW 5 144174934 missense probably benign 0.02
R5818:Lmtk2 UTSW 5 144156900 missense probably benign 0.07
R5984:Lmtk2 UTSW 5 144174838 missense probably benign
R6083:Lmtk2 UTSW 5 144182756 missense probably damaging 1.00
R6180:Lmtk2 UTSW 5 144175342 missense probably damaging 1.00
R6411:Lmtk2 UTSW 5 144174586 missense probably damaging 0.99
R6544:Lmtk2 UTSW 5 144173806 missense possibly damaging 0.68
R6628:Lmtk2 UTSW 5 144174685 missense probably benign 0.03
R6698:Lmtk2 UTSW 5 144174919 missense probably benign 0.02
R6742:Lmtk2 UTSW 5 144148357 missense probably damaging 1.00
R6763:Lmtk2 UTSW 5 144173797 missense probably damaging 1.00
X0024:Lmtk2 UTSW 5 144174250 missense probably benign 0.22
Z1088:Lmtk2 UTSW 5 144182851 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- TCAACTTGCACAGCCTAAGC -3'
(R):5'- CTGGCATGAATAGCCATGGG -3'

Sequencing Primer
(F):5'- GCCTAAGCTCTGAGTCTGAAGAC -3'
(R):5'- CATAAGGTCTGGAGTTCAAGTCCC -3'
Posted On2016-05-10