Incidental Mutation 'R4993:Pigr'
ID384964
Institutional Source Beutler Lab
Gene Symbol Pigr
Ensembl Gene ENSMUSG00000026417
Gene Namepolymeric immunoglobulin receptor
Synonyms
MMRRC Submission 042587-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.026) question?
Stock #R4993 (G1)
Quality Score209
Status Not validated
Chromosome1
Chromosomal Location130826684-130852249 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 130841817 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 122 (D122N)
Ref Sequence ENSEMBL: ENSMUSP00000121686 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027675] [ENSMUST00000133792] [ENSMUST00000137782]
Predicted Effect probably benign
Transcript: ENSMUST00000027675
AA Change: D122N

PolyPhen 2 Score 0.257 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000027675
Gene: ENSMUSG00000026417
AA Change: D122N

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 25 128 1.6e-8 SMART
IG 137 238 8.1e-8 SMART
IG 242 346 1.4e-3 SMART
IG 355 457 3.1e-5 SMART
IG 469 563 1e-10 SMART
IG_like 483 548 8e-3 SMART
low complexity region 627 644 N/A INTRINSIC
transmembrane domain 646 668 N/A INTRINSIC
low complexity region 730 746 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133792
AA Change: D122N

PolyPhen 2 Score 0.264 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000121686
Gene: ENSMUSG00000026417
AA Change: D122N

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 25 128 1.6e-8 SMART
Blast:IG 137 210 3e-47 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000137782
AA Change: D122N

PolyPhen 2 Score 0.257 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000114334
Gene: ENSMUSG00000026417
AA Change: D122N

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 25 128 3.91e-6 SMART
Blast:IG 137 201 4e-40 BLAST
Meta Mutation Damage Score 0.074 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the immunoglobulin superfamily. The encoded poly-Ig receptor binds polymeric immunoglobulin molecules at the basolateral surface of epithelial cells; the complex is then transported across the cell to be secreted at the apical surface. A significant association was found between immunoglobulin A nephropathy and several SNPs in this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Nullizygous mice show impaired transepithelial transport of dimeric IgA, increased serum IgA levels and mucosal leakiness. Studies of one null allele show increased susceptibility to mycobacterial infections while another allele causes impaired clearanceof the protozoan parasite Giardia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
9130008F23Rik G T 17: 40,880,161 Q126K probably benign Het
Abca15 C A 7: 120,401,718 N1492K probably damaging Het
Afap1l2 C T 19: 56,918,040 D402N probably damaging Het
Akap11 A G 14: 78,512,968 F660L probably damaging Het
Bcl3 T C 7: 19,820,177 T89A probably benign Het
Bub1b T C 2: 118,636,770 I858T possibly damaging Het
Cdk19 A G 10: 40,476,218 D288G possibly damaging Het
Cyp2d34 T A 15: 82,618,329 D202V probably damaging Het
Dip2c T G 13: 9,575,223 Y584* probably null Het
Dpf3 A T 12: 83,331,861 probably null Het
Drp2 G A X: 134,441,316 R567H probably damaging Homo
Emid1 G T 11: 5,131,512 Q212K probably benign Het
Esm1 C T 13: 113,213,399 Q118* probably null Het
Fahd2a T G 2: 127,436,364 I308L probably benign Het
Fam208a T A 14: 27,429,114 W16R possibly damaging Het
Fanci T C 7: 79,435,378 *851Q probably null Het
Fastkd1 C A 2: 69,702,740 V428F probably damaging Het
Fat2 A T 11: 55,283,092 I2265N probably damaging Het
Gale C A 4: 135,966,860 H191Q probably damaging Het
Ghsr T A 3: 27,372,254 V153E possibly damaging Het
Gm10696 C T 3: 94,176,316 G63R probably damaging Het
Gpc6 A G 14: 117,624,539 N289S possibly damaging Het
Hoxb6 A T 11: 96,300,711 Y153F probably damaging Het
Ints3 T C 3: 90,415,507 T139A probably benign Het
Irf2bp2 A G 8: 126,592,671 S256P probably benign Het
Klf4 G T 4: 55,530,640 P148Q probably damaging Het
Loxl1 T G 9: 58,312,537 H117P probably damaging Het
Lpl A G 8: 68,895,793 K225E probably benign Het
Lrba T A 3: 86,360,037 V1678D probably damaging Het
Med1 A T 11: 98,163,904 F398Y probably damaging Het
Mfap2 T C 4: 141,015,578 *186Q probably null Het
Mfsd3 T C 15: 76,701,982 L105P probably damaging Het
Mlxip T G 5: 123,395,294 I122S probably damaging Het
Mmrn2 A T 14: 34,396,398 Y107F probably damaging Het
Mtg1 G T 7: 140,140,283 D88Y probably null Het
Mutyh T A 4: 116,817,935 S426R probably benign Het
Myo16 C T 8: 10,476,094 T878I probably damaging Het
Myo9a T A 9: 59,861,472 Y912* probably null Het
Ncor1 A C 11: 62,343,341 I669R probably damaging Het
Ndufs1 T C 1: 63,163,776 I210V probably benign Het
Nek9 A G 12: 85,310,420 C657R probably damaging Het
Noct C T 3: 51,250,021 T260I probably damaging Het
Nr1h4 A T 10: 89,498,180 M102K probably benign Het
Obscn G A 11: 59,124,761 R1054C possibly damaging Het
Olfr1124 T A 2: 87,435,152 F222I probably benign Het
Olfr352 C A 2: 36,869,988 Q141K probably benign Het
Olfr47 A G 6: 43,236,456 M283V possibly damaging Het
Olfr501-ps1 G A 7: 108,508,243 M62I probably damaging Het
Olfr615 T A 7: 103,561,317 I280N possibly damaging Het
Olfr619 A T 7: 103,603,656 M1L probably benign Het
Otol1 C A 3: 70,018,878 Q129K probably benign Het
Otx1 A T 11: 21,998,532 probably null Het
Pcdhac2 C A 18: 37,146,251 N761K probably damaging Het
Pde1c A T 6: 56,150,624 M452K probably damaging Het
Phkg2 T C 7: 127,573,941 Y24H probably damaging Het
Prg4 C T 1: 150,460,681 C97Y probably damaging Het
Ptdss1 T C 13: 66,945,288 V64A probably benign Het
Ralgapa2 T C 2: 146,447,311 K324E probably damaging Het
Rfx5 G A 3: 94,955,815 V73I probably benign Het
Riiad1 T C 3: 94,472,863 T42A probably benign Het
Rims2 T C 15: 39,454,445 V640A possibly damaging Het
Rnpep G T 1: 135,263,032 S592Y possibly damaging Het
Scap T C 9: 110,378,390 L431P probably damaging Het
Siglec1 T A 2: 131,073,361 I1437F possibly damaging Het
Skint1 T C 4: 112,028,333 probably null Het
Slc44a1 A G 4: 53,543,644 E396G probably damaging Het
Slc4a2 T C 5: 24,434,869 F521S probably damaging Het
Smarcc1 T A 9: 110,175,061 S394R probably damaging Het
Socs1 A G 16: 10,784,685 S63P probably benign Het
Sun1 T G 5: 139,225,333 S20A possibly damaging Het
Tac4 A T 11: 95,265,242 K50* probably null Het
Tcaf2 A G 6: 42,642,640 I151T probably damaging Het
Tcf4 T C 18: 69,681,769 V587A probably damaging Het
Ttc37 T A 13: 76,182,936 M1495K probably damaging Het
Ttn T A 2: 76,740,909 K24801* probably null Het
Tuba3b G T 6: 145,621,273 M413I possibly damaging Het
Ufl1 C T 4: 25,267,832 A280T possibly damaging Het
Ugt2b5 T A 5: 87,139,673 I212L probably benign Het
Umodl1 A G 17: 30,986,485 T685A probably benign Het
Uqcrc1 T A 9: 108,944,810 V183D probably damaging Het
Ush2a A G 1: 188,910,720 N4093S probably benign Het
Vmn1r167 C T 7: 23,505,228 S121N probably damaging Het
Vmn1r47 A G 6: 90,022,758 S291G possibly damaging Het
Vmn2r108 A G 17: 20,481,187 V17A probably benign Het
Vmn2r58 T A 7: 41,837,752 H573L probably benign Het
Xirp1 C T 9: 120,018,792 V342I probably damaging Het
Zfp462 A G 4: 55,051,204 M2226V possibly damaging Het
Zfp467 G A 6: 48,439,029 H230Y probably damaging Het
Zfp595 T A 13: 67,316,401 K599N probably damaging Het
Zfp819 C A 7: 43,617,296 T401K probably benign Het
Other mutations in Pigr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00815:Pigr APN 1 130834430 start codon destroyed probably null 1.00
IGL01565:Pigr APN 1 130844474 missense possibly damaging 0.93
IGL01592:Pigr APN 1 130849058 missense probably damaging 1.00
IGL02153:Pigr APN 1 130849056 unclassified probably null
IGL02508:Pigr APN 1 130850858 missense probably benign 0.02
IGL02815:Pigr APN 1 130841821 missense probably damaging 1.00
R0834:Pigr UTSW 1 130844544 nonsense probably null
R1453:Pigr UTSW 1 130841544 missense probably benign 0.00
R1728:Pigr UTSW 1 130844522 missense possibly damaging 0.50
R1729:Pigr UTSW 1 130844522 missense possibly damaging 0.50
R1730:Pigr UTSW 1 130844522 missense possibly damaging 0.50
R1736:Pigr UTSW 1 130841803 missense possibly damaging 0.92
R1739:Pigr UTSW 1 130844522 missense possibly damaging 0.50
R1742:Pigr UTSW 1 130845086 missense probably damaging 1.00
R1762:Pigr UTSW 1 130844522 missense possibly damaging 0.50
R1783:Pigr UTSW 1 130844522 missense possibly damaging 0.50
R1784:Pigr UTSW 1 130844522 missense possibly damaging 0.50
R1785:Pigr UTSW 1 130844522 missense possibly damaging 0.50
R1929:Pigr UTSW 1 130846662 unclassified probably benign
R2065:Pigr UTSW 1 130850880 missense probably benign 0.20
R2275:Pigr UTSW 1 130846470 missense probably benign 0.00
R2513:Pigr UTSW 1 130846620 missense possibly damaging 0.71
R2910:Pigr UTSW 1 130849533 missense probably damaging 1.00
R2911:Pigr UTSW 1 130849533 missense probably damaging 1.00
R2964:Pigr UTSW 1 130841535 missense probably damaging 1.00
R3857:Pigr UTSW 1 130847261 missense probably benign 0.06
R4165:Pigr UTSW 1 130841817 missense probably benign 0.26
R4166:Pigr UTSW 1 130841817 missense probably benign 0.26
R4303:Pigr UTSW 1 130841817 missense probably benign 0.26
R4735:Pigr UTSW 1 130846554 missense probably damaging 0.99
R4909:Pigr UTSW 1 130848458 missense possibly damaging 0.77
R4994:Pigr UTSW 1 130841817 missense probably benign 0.26
R5033:Pigr UTSW 1 130844699 missense probably damaging 1.00
R5116:Pigr UTSW 1 130849031 missense probably benign 0.00
R5304:Pigr UTSW 1 130849493 missense probably benign 0.00
R5440:Pigr UTSW 1 130849622 splice site probably null
R5853:Pigr UTSW 1 130846604 nonsense probably null
R5934:Pigr UTSW 1 130844527 missense probably damaging 0.98
R6015:Pigr UTSW 1 130847261 missense probably benign 0.06
R6291:Pigr UTSW 1 130841761 missense probably benign 0.06
R6749:Pigr UTSW 1 130846548 missense probably benign 0.14
R6941:Pigr UTSW 1 130847327 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGCTCATCTCTTCAAATGGC -3'
(R):5'- ACGACATGGTAAGTCTCACCC -3'

Sequencing Primer
(F):5'- TTCAAATGGCTACCTCTCCAAG -3'
(R):5'- GACATGGTAAGTCTCACCCATTCC -3'
Posted On2016-05-10