Incidental Mutation 'R4993:Ralgapa2'
ID384975
Institutional Source Beutler Lab
Gene Symbol Ralgapa2
Ensembl Gene ENSMUSG00000037110
Gene NameRal GTPase activating protein, alpha subunit 2 (catalytic)
SynonymsAS250, RGC2, A230067G21Rik
MMRRC Submission 042587-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.318) question?
Stock #R4993 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location146239879-146512344 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 146447311 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 324 (K324E)
Ref Sequence ENSEMBL: ENSMUSP00000153734 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109986] [ENSMUST00000131824] [ENSMUST00000228797]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000109982
Predicted Effect probably damaging
Transcript: ENSMUST00000109986
AA Change: K324E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105613
Gene: ENSMUSG00000037110
AA Change: K324E

DomainStartEndE-ValueType
low complexity region 469 480 N/A INTRINSIC
low complexity region 1017 1028 N/A INTRINSIC
low complexity region 1296 1301 N/A INTRINSIC
Pfam:Rap_GAP 1701 1877 6.8e-48 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000131824
AA Change: K324E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000122039
Gene: ENSMUSG00000037110
AA Change: K324E

DomainStartEndE-ValueType
low complexity region 469 480 N/A INTRINSIC
low complexity region 979 990 N/A INTRINSIC
low complexity region 1258 1263 N/A INTRINSIC
Pfam:Rap_GAP 1663 1842 1.3e-66 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135974
Predicted Effect probably benign
Transcript: ENSMUST00000149499
SMART Domains Protein: ENSMUSP00000122017
Gene: ENSMUSG00000037110

DomainStartEndE-ValueType
low complexity region 140 151 N/A INTRINSIC
low complexity region 650 661 N/A INTRINSIC
low complexity region 929 934 N/A INTRINSIC
Pfam:Rap_GAP 1334 1511 2.4e-48 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000228797
AA Change: K324E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased incidence and severity of induced urothelial bladder tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
9130008F23Rik G T 17: 40,880,161 Q126K probably benign Het
Abca15 C A 7: 120,401,718 N1492K probably damaging Het
Afap1l2 C T 19: 56,918,040 D402N probably damaging Het
Akap11 A G 14: 78,512,968 F660L probably damaging Het
Bcl3 T C 7: 19,820,177 T89A probably benign Het
Bub1b T C 2: 118,636,770 I858T possibly damaging Het
Cdk19 A G 10: 40,476,218 D288G possibly damaging Het
Cyp2d34 T A 15: 82,618,329 D202V probably damaging Het
Dip2c T G 13: 9,575,223 Y584* probably null Het
Dpf3 A T 12: 83,331,861 probably null Het
Drp2 G A X: 134,441,316 R567H probably damaging Homo
Emid1 G T 11: 5,131,512 Q212K probably benign Het
Esm1 C T 13: 113,213,399 Q118* probably null Het
Fahd2a T G 2: 127,436,364 I308L probably benign Het
Fam208a T A 14: 27,429,114 W16R possibly damaging Het
Fanci T C 7: 79,435,378 *851Q probably null Het
Fastkd1 C A 2: 69,702,740 V428F probably damaging Het
Fat2 A T 11: 55,283,092 I2265N probably damaging Het
Gale C A 4: 135,966,860 H191Q probably damaging Het
Ghsr T A 3: 27,372,254 V153E possibly damaging Het
Gm10696 C T 3: 94,176,316 G63R probably damaging Het
Gpc6 A G 14: 117,624,539 N289S possibly damaging Het
Hoxb6 A T 11: 96,300,711 Y153F probably damaging Het
Ints3 T C 3: 90,415,507 T139A probably benign Het
Irf2bp2 A G 8: 126,592,671 S256P probably benign Het
Klf4 G T 4: 55,530,640 P148Q probably damaging Het
Loxl1 T G 9: 58,312,537 H117P probably damaging Het
Lpl A G 8: 68,895,793 K225E probably benign Het
Lrba T A 3: 86,360,037 V1678D probably damaging Het
Med1 A T 11: 98,163,904 F398Y probably damaging Het
Mfap2 T C 4: 141,015,578 *186Q probably null Het
Mfsd3 T C 15: 76,701,982 L105P probably damaging Het
Mlxip T G 5: 123,395,294 I122S probably damaging Het
Mmrn2 A T 14: 34,396,398 Y107F probably damaging Het
Mtg1 G T 7: 140,140,283 D88Y probably null Het
Mutyh T A 4: 116,817,935 S426R probably benign Het
Myo16 C T 8: 10,476,094 T878I probably damaging Het
Myo9a T A 9: 59,861,472 Y912* probably null Het
Ncor1 A C 11: 62,343,341 I669R probably damaging Het
Ndufs1 T C 1: 63,163,776 I210V probably benign Het
Nek9 A G 12: 85,310,420 C657R probably damaging Het
Noct C T 3: 51,250,021 T260I probably damaging Het
Nr1h4 A T 10: 89,498,180 M102K probably benign Het
Obscn G A 11: 59,124,761 R1054C possibly damaging Het
Olfr1124 T A 2: 87,435,152 F222I probably benign Het
Olfr352 C A 2: 36,869,988 Q141K probably benign Het
Olfr47 A G 6: 43,236,456 M283V possibly damaging Het
Olfr501-ps1 G A 7: 108,508,243 M62I probably damaging Het
Olfr615 T A 7: 103,561,317 I280N possibly damaging Het
Olfr619 A T 7: 103,603,656 M1L probably benign Het
Otol1 C A 3: 70,018,878 Q129K probably benign Het
Otx1 A T 11: 21,998,532 probably null Het
Pcdhac2 C A 18: 37,146,251 N761K probably damaging Het
Pde1c A T 6: 56,150,624 M452K probably damaging Het
Phkg2 T C 7: 127,573,941 Y24H probably damaging Het
Pigr G A 1: 130,841,817 D122N probably benign Het
Prg4 C T 1: 150,460,681 C97Y probably damaging Het
Ptdss1 T C 13: 66,945,288 V64A probably benign Het
Rfx5 G A 3: 94,955,815 V73I probably benign Het
Riiad1 T C 3: 94,472,863 T42A probably benign Het
Rims2 T C 15: 39,454,445 V640A possibly damaging Het
Rnpep G T 1: 135,263,032 S592Y possibly damaging Het
Scap T C 9: 110,378,390 L431P probably damaging Het
Siglec1 T A 2: 131,073,361 I1437F possibly damaging Het
Skint1 T C 4: 112,028,333 probably null Het
Slc44a1 A G 4: 53,543,644 E396G probably damaging Het
Slc4a2 T C 5: 24,434,869 F521S probably damaging Het
Smarcc1 T A 9: 110,175,061 S394R probably damaging Het
Socs1 A G 16: 10,784,685 S63P probably benign Het
Sun1 T G 5: 139,225,333 S20A possibly damaging Het
Tac4 A T 11: 95,265,242 K50* probably null Het
Tcaf2 A G 6: 42,642,640 I151T probably damaging Het
Tcf4 T C 18: 69,681,769 V587A probably damaging Het
Ttc37 T A 13: 76,182,936 M1495K probably damaging Het
Ttn T A 2: 76,740,909 K24801* probably null Het
Tuba3b G T 6: 145,621,273 M413I possibly damaging Het
Ufl1 C T 4: 25,267,832 A280T possibly damaging Het
Ugt2b5 T A 5: 87,139,673 I212L probably benign Het
Umodl1 A G 17: 30,986,485 T685A probably benign Het
Uqcrc1 T A 9: 108,944,810 V183D probably damaging Het
Ush2a A G 1: 188,910,720 N4093S probably benign Het
Vmn1r167 C T 7: 23,505,228 S121N probably damaging Het
Vmn1r47 A G 6: 90,022,758 S291G possibly damaging Het
Vmn2r108 A G 17: 20,481,187 V17A probably benign Het
Vmn2r58 T A 7: 41,837,752 H573L probably benign Het
Xirp1 C T 9: 120,018,792 V342I probably damaging Het
Zfp462 A G 4: 55,051,204 M2226V possibly damaging Het
Zfp467 G A 6: 48,439,029 H230Y probably damaging Het
Zfp595 T A 13: 67,316,401 K599N probably damaging Het
Zfp819 C A 7: 43,617,296 T401K probably benign Het
Other mutations in Ralgapa2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00666:Ralgapa2 APN 2 146485136 missense possibly damaging 0.61
IGL00915:Ralgapa2 APN 2 146342522 missense probably damaging 1.00
IGL01012:Ralgapa2 APN 2 146421739 missense possibly damaging 0.95
IGL01018:Ralgapa2 APN 2 146410193 missense probably benign 0.02
IGL01018:Ralgapa2 APN 2 146410192 missense probably benign 0.00
IGL01902:Ralgapa2 APN 2 146315014 missense probably damaging 1.00
IGL02160:Ralgapa2 APN 2 146348440 splice site probably benign
IGL02321:Ralgapa2 APN 2 146412816 nonsense probably null
IGL02412:Ralgapa2 APN 2 146412132 missense probably damaging 0.96
IGL03026:Ralgapa2 APN 2 146460775 splice site probably benign
IGL03115:Ralgapa2 APN 2 146424814 missense probably damaging 0.99
IGL03256:Ralgapa2 APN 2 146460712 critical splice donor site probably null
IGL03379:Ralgapa2 APN 2 146357987 missense probably benign 0.01
P4748:Ralgapa2 UTSW 2 146346811 nonsense probably null
R0012:Ralgapa2 UTSW 2 146412752 missense probably benign
R0012:Ralgapa2 UTSW 2 146412752 missense probably benign
R0165:Ralgapa2 UTSW 2 146388487 splice site probably benign
R0344:Ralgapa2 UTSW 2 146346794 missense possibly damaging 0.69
R0402:Ralgapa2 UTSW 2 146434809 missense probably damaging 0.98
R0419:Ralgapa2 UTSW 2 146428672 missense possibly damaging 0.69
R0638:Ralgapa2 UTSW 2 146342192 missense probably benign 0.00
R0704:Ralgapa2 UTSW 2 146451784 missense probably damaging 1.00
R0722:Ralgapa2 UTSW 2 146388531 missense probably damaging 1.00
R0866:Ralgapa2 UTSW 2 146436003 missense probably damaging 1.00
R1065:Ralgapa2 UTSW 2 146450558 missense probably benign 0.00
R1212:Ralgapa2 UTSW 2 146357982 missense probably benign 0.00
R1395:Ralgapa2 UTSW 2 146388500 missense probably damaging 1.00
R1614:Ralgapa2 UTSW 2 146388612 missense probably damaging 1.00
R1686:Ralgapa2 UTSW 2 146358000 missense probably benign 0.09
R1799:Ralgapa2 UTSW 2 146342728 missense probably benign 0.02
R1905:Ralgapa2 UTSW 2 146387701 missense probably damaging 1.00
R1956:Ralgapa2 UTSW 2 146460759 missense probably benign 0.00
R2144:Ralgapa2 UTSW 2 146388604 missense probably damaging 1.00
R2148:Ralgapa2 UTSW 2 146431887 missense probably benign 0.02
R2219:Ralgapa2 UTSW 2 146421679 missense probably benign 0.09
R2220:Ralgapa2 UTSW 2 146421679 missense probably benign 0.09
R2261:Ralgapa2 UTSW 2 146342683 missense probably damaging 1.00
R2402:Ralgapa2 UTSW 2 146353192 missense probably damaging 1.00
R2495:Ralgapa2 UTSW 2 146361400 missense possibly damaging 0.82
R3752:Ralgapa2 UTSW 2 146421631 missense possibly damaging 0.94
R3953:Ralgapa2 UTSW 2 146435964 missense probably damaging 1.00
R3956:Ralgapa2 UTSW 2 146435964 missense probably damaging 1.00
R4177:Ralgapa2 UTSW 2 146485163 missense probably damaging 1.00
R4182:Ralgapa2 UTSW 2 146435994 missense probably damaging 1.00
R4193:Ralgapa2 UTSW 2 146342573 missense probably damaging 1.00
R4332:Ralgapa2 UTSW 2 146260368 missense probably benign 0.10
R4507:Ralgapa2 UTSW 2 146353248 missense probably benign 0.11
R4574:Ralgapa2 UTSW 2 146435999 missense probably damaging 1.00
R4585:Ralgapa2 UTSW 2 146315024 missense probably damaging 0.99
R4627:Ralgapa2 UTSW 2 146361453 missense possibly damaging 0.88
R4647:Ralgapa2 UTSW 2 146387629 missense possibly damaging 0.69
R4677:Ralgapa2 UTSW 2 146345467 missense possibly damaging 0.82
R4724:Ralgapa2 UTSW 2 146345533 missense possibly damaging 0.46
R4760:Ralgapa2 UTSW 2 146346749 missense probably benign 0.00
R4831:Ralgapa2 UTSW 2 146405067 intron probably benign
R4962:Ralgapa2 UTSW 2 146434834 nonsense probably null
R5041:Ralgapa2 UTSW 2 146485151 missense probably benign 0.00
R5120:Ralgapa2 UTSW 2 146412084 missense probably benign 0.26
R5185:Ralgapa2 UTSW 2 146388486 splice site probably null
R5393:Ralgapa2 UTSW 2 146345455 missense probably damaging 1.00
R5428:Ralgapa2 UTSW 2 146334494 missense probably damaging 0.96
R5439:Ralgapa2 UTSW 2 146342510 missense probably benign 0.08
R5476:Ralgapa2 UTSW 2 146447436 missense probably benign
R5695:Ralgapa2 UTSW 2 146333477 missense probably damaging 1.00
R5705:Ralgapa2 UTSW 2 146449273 missense probably damaging 1.00
R5718:Ralgapa2 UTSW 2 146453406 splice site probably null
R5817:Ralgapa2 UTSW 2 146333486 missense probably damaging 1.00
R5877:Ralgapa2 UTSW 2 146388569 missense probably damaging 1.00
R5994:Ralgapa2 UTSW 2 146361453 missense probably benign 0.00
R6048:Ralgapa2 UTSW 2 146434845 missense possibly damaging 0.46
R6158:Ralgapa2 UTSW 2 146424676 missense possibly damaging 0.69
R6169:Ralgapa2 UTSW 2 146450465 missense probably damaging 1.00
R6280:Ralgapa2 UTSW 2 146342209 missense probably damaging 1.00
R6301:Ralgapa2 UTSW 2 146327411 missense possibly damaging 0.94
R6650:Ralgapa2 UTSW 2 146388502 missense probably damaging 1.00
R6959:Ralgapa2 UTSW 2 146342701 missense probably damaging 0.98
R7020:Ralgapa2 UTSW 2 146346718 nonsense probably null
R7035:Ralgapa2 UTSW 2 146511857 missense probably damaging 1.00
X0019:Ralgapa2 UTSW 2 146388652 missense possibly damaging 0.56
Z1088:Ralgapa2 UTSW 2 146434905 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- TCAGACCTGCAGACAAGTG -3'
(R):5'- TGGAACAGTTCACAGGGATTATG -3'

Sequencing Primer
(F):5'- CCTGCAGACAAGTGAGCCAG -3'
(R):5'- GAACAGTTCACAGGGATTATGTAATG -3'
Posted On2016-05-10