Incidental Mutation 'R4993:Zfp462'
ID384987
Institutional Source Beutler Lab
Gene Symbol Zfp462
Ensembl Gene ENSMUSG00000060206
Gene Namezinc finger protein 462
SynonymsZfpip, 9430078C22Rik, Gt4-2
MMRRC Submission 042587-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.416) question?
Stock #R4993 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location54945048-55083563 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 55051204 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 2226 (M2226V)
Ref Sequence ENSEMBL: ENSMUSP00000095677 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030131] [ENSMUST00000079605] [ENSMUST00000098070]
Predicted Effect probably benign
Transcript: ENSMUST00000030131
AA Change: M1138V

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000030131
Gene: ENSMUSG00000060206
AA Change: M1138V

DomainStartEndE-ValueType
ZnF_C2H2 35 58 4.81e0 SMART
ZnF_C2H2 106 129 6.67e-2 SMART
ZnF_C2H2 153 176 3.47e0 SMART
ZnF_C2H2 210 233 7.29e0 SMART
ZnF_C2H2 311 334 2.17e-1 SMART
ZnF_C2H2 356 379 6.57e0 SMART
ZnF_C2H2 418 441 5.34e-1 SMART
low complexity region 450 463 N/A INTRINSIC
ZnF_C2H2 501 524 8.22e-2 SMART
ZnF_C2H2 538 561 5.34e0 SMART
ZnF_C2H2 608 631 6.4e0 SMART
low complexity region 655 676 N/A INTRINSIC
ZnF_C2H2 687 711 3.05e1 SMART
ZnF_C2H2 733 755 1.08e-1 SMART
low complexity region 757 771 N/A INTRINSIC
ZnF_C2H2 809 831 1.51e0 SMART
ZnF_C2H2 892 914 3.11e-2 SMART
ZnF_C2H2 926 948 4.11e-2 SMART
ZnF_C2H2 955 978 4.98e-1 SMART
ZnF_C2H2 984 1007 5.5e-3 SMART
ZnF_C2H2 1092 1115 7.05e-1 SMART
ZnF_C2H2 1121 1144 5.48e0 SMART
ZnF_C2H2 1155 1177 6.13e-1 SMART
ZnF_C2H2 1201 1223 1.26e-2 SMART
ZnF_C2H2 1229 1252 2.02e-1 SMART
low complexity region 1273 1296 N/A INTRINSIC
ZnF_C2H2 1315 1337 2.2e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000079605
AA Change: M1139V

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000078555
Gene: ENSMUSG00000060206
AA Change: M1139V

DomainStartEndE-ValueType
ZnF_C2H2 35 58 4.81e0 SMART
ZnF_C2H2 106 129 6.67e-2 SMART
ZnF_C2H2 153 176 3.47e0 SMART
ZnF_C2H2 210 233 7.29e0 SMART
ZnF_C2H2 311 334 2.17e-1 SMART
ZnF_C2H2 356 379 6.57e0 SMART
ZnF_C2H2 418 441 5.34e-1 SMART
low complexity region 450 463 N/A INTRINSIC
ZnF_C2H2 501 524 8.22e-2 SMART
ZnF_C2H2 538 561 5.34e0 SMART
ZnF_C2H2 608 631 6.4e0 SMART
low complexity region 655 676 N/A INTRINSIC
ZnF_C2H2 687 711 3.05e1 SMART
ZnF_C2H2 733 755 1.08e-1 SMART
low complexity region 757 771 N/A INTRINSIC
ZnF_C2H2 809 831 1.51e0 SMART
ZnF_C2H2 893 915 3.11e-2 SMART
ZnF_C2H2 927 949 4.11e-2 SMART
ZnF_C2H2 956 979 4.98e-1 SMART
ZnF_C2H2 985 1008 5.5e-3 SMART
ZnF_C2H2 1093 1116 7.05e-1 SMART
ZnF_C2H2 1122 1145 5.48e0 SMART
ZnF_C2H2 1156 1178 6.13e-1 SMART
ZnF_C2H2 1202 1224 1.26e-2 SMART
ZnF_C2H2 1230 1253 2.02e-1 SMART
low complexity region 1274 1297 N/A INTRINSIC
ZnF_C2H2 1316 1338 2.2e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000098070
AA Change: M2226V

PolyPhen 2 Score 0.619 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000095677
Gene: ENSMUSG00000060206
AA Change: M2226V

DomainStartEndE-ValueType
ZnF_C2H2 4 27 5.81e-2 SMART
low complexity region 81 94 N/A INTRINSIC
ZnF_C2H2 108 131 1.79e-2 SMART
ZnF_C2H2 162 185 4.65e-1 SMART
low complexity region 194 215 N/A INTRINSIC
ZnF_C2H2 243 266 4.98e-1 SMART
low complexity region 332 343 N/A INTRINSIC
ZnF_C2H2 440 463 1.01e-1 SMART
ZnF_C2H2 471 493 2.86e-1 SMART
low complexity region 503 515 N/A INTRINSIC
low complexity region 536 592 N/A INTRINSIC
ZnF_C2H2 593 616 2.53e-2 SMART
low complexity region 707 736 N/A INTRINSIC
ZnF_C2H2 835 858 5.62e0 SMART
ZnF_C2H2 878 900 2.14e0 SMART
ZnF_C2H2 917 940 6.67e-2 SMART
ZnF_C2H2 1023 1046 5.72e-1 SMART
low complexity region 1092 1100 N/A INTRINSIC
ZnF_C2H2 1107 1130 4.23e0 SMART
ZnF_C2H2 1183 1206 4.81e0 SMART
ZnF_C2H2 1254 1277 6.67e-2 SMART
ZnF_C2H2 1301 1324 3.47e0 SMART
ZnF_C2H2 1358 1381 7.29e0 SMART
ZnF_C2H2 1459 1482 2.17e-1 SMART
ZnF_C2H2 1504 1527 6.57e0 SMART
ZnF_C2H2 1566 1589 5.34e-1 SMART
low complexity region 1598 1611 N/A INTRINSIC
ZnF_C2H2 1649 1672 8.22e-2 SMART
ZnF_C2H2 1686 1709 5.34e0 SMART
ZnF_C2H2 1756 1779 6.4e0 SMART
low complexity region 1803 1824 N/A INTRINSIC
ZnF_C2H2 1835 1859 3.05e1 SMART
ZnF_C2H2 1881 1903 1.08e-1 SMART
low complexity region 1905 1919 N/A INTRINSIC
ZnF_C2H2 1957 1979 1.51e0 SMART
ZnF_C2H2 2014 2036 4.11e-2 SMART
ZnF_C2H2 2043 2066 4.98e-1 SMART
ZnF_C2H2 2072 2095 5.5e-3 SMART
ZnF_C2H2 2180 2203 7.05e-1 SMART
ZnF_C2H2 2209 2232 5.48e0 SMART
ZnF_C2H2 2243 2265 6.13e-1 SMART
ZnF_C2H2 2289 2311 1.26e-2 SMART
ZnF_C2H2 2317 2340 2.02e-1 SMART
low complexity region 2361 2384 N/A INTRINSIC
ZnF_C2H2 2403 2425 2.2e-2 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to C2H2-type zinc finger family of proteins. It contains multiple C2H2-type zinc fingers and may be involved in transcriptional regulation. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
9130008F23Rik G T 17: 40,880,161 Q126K probably benign Het
Abca15 C A 7: 120,401,718 N1492K probably damaging Het
Afap1l2 C T 19: 56,918,040 D402N probably damaging Het
Akap11 A G 14: 78,512,968 F660L probably damaging Het
Bcl3 T C 7: 19,820,177 T89A probably benign Het
Bub1b T C 2: 118,636,770 I858T possibly damaging Het
Cdk19 A G 10: 40,476,218 D288G possibly damaging Het
Cyp2d34 T A 15: 82,618,329 D202V probably damaging Het
Dip2c T G 13: 9,575,223 Y584* probably null Het
Dpf3 A T 12: 83,331,861 probably null Het
Drp2 G A X: 134,441,316 R567H probably damaging Homo
Emid1 G T 11: 5,131,512 Q212K probably benign Het
Esm1 C T 13: 113,213,399 Q118* probably null Het
Fahd2a T G 2: 127,436,364 I308L probably benign Het
Fam208a T A 14: 27,429,114 W16R possibly damaging Het
Fanci T C 7: 79,435,378 *851Q probably null Het
Fastkd1 C A 2: 69,702,740 V428F probably damaging Het
Fat2 A T 11: 55,283,092 I2265N probably damaging Het
Gale C A 4: 135,966,860 H191Q probably damaging Het
Ghsr T A 3: 27,372,254 V153E possibly damaging Het
Gm10696 C T 3: 94,176,316 G63R probably damaging Het
Gpc6 A G 14: 117,624,539 N289S possibly damaging Het
Hoxb6 A T 11: 96,300,711 Y153F probably damaging Het
Ints3 T C 3: 90,415,507 T139A probably benign Het
Irf2bp2 A G 8: 126,592,671 S256P probably benign Het
Klf4 G T 4: 55,530,640 P148Q probably damaging Het
Loxl1 T G 9: 58,312,537 H117P probably damaging Het
Lpl A G 8: 68,895,793 K225E probably benign Het
Lrba T A 3: 86,360,037 V1678D probably damaging Het
Med1 A T 11: 98,163,904 F398Y probably damaging Het
Mfap2 T C 4: 141,015,578 *186Q probably null Het
Mfsd3 T C 15: 76,701,982 L105P probably damaging Het
Mlxip T G 5: 123,395,294 I122S probably damaging Het
Mmrn2 A T 14: 34,396,398 Y107F probably damaging Het
Mtg1 G T 7: 140,140,283 D88Y probably null Het
Mutyh T A 4: 116,817,935 S426R probably benign Het
Myo16 C T 8: 10,476,094 T878I probably damaging Het
Myo9a T A 9: 59,861,472 Y912* probably null Het
Ncor1 A C 11: 62,343,341 I669R probably damaging Het
Ndufs1 T C 1: 63,163,776 I210V probably benign Het
Nek9 A G 12: 85,310,420 C657R probably damaging Het
Noct C T 3: 51,250,021 T260I probably damaging Het
Nr1h4 A T 10: 89,498,180 M102K probably benign Het
Obscn G A 11: 59,124,761 R1054C possibly damaging Het
Olfr1124 T A 2: 87,435,152 F222I probably benign Het
Olfr352 C A 2: 36,869,988 Q141K probably benign Het
Olfr47 A G 6: 43,236,456 M283V possibly damaging Het
Olfr501-ps1 G A 7: 108,508,243 M62I probably damaging Het
Olfr615 T A 7: 103,561,317 I280N possibly damaging Het
Olfr619 A T 7: 103,603,656 M1L probably benign Het
Otol1 C A 3: 70,018,878 Q129K probably benign Het
Otx1 A T 11: 21,998,532 probably null Het
Pcdhac2 C A 18: 37,146,251 N761K probably damaging Het
Pde1c A T 6: 56,150,624 M452K probably damaging Het
Phkg2 T C 7: 127,573,941 Y24H probably damaging Het
Pigr G A 1: 130,841,817 D122N probably benign Het
Prg4 C T 1: 150,460,681 C97Y probably damaging Het
Ptdss1 T C 13: 66,945,288 V64A probably benign Het
Ralgapa2 T C 2: 146,447,311 K324E probably damaging Het
Rfx5 G A 3: 94,955,815 V73I probably benign Het
Riiad1 T C 3: 94,472,863 T42A probably benign Het
Rims2 T C 15: 39,454,445 V640A possibly damaging Het
Rnpep G T 1: 135,263,032 S592Y possibly damaging Het
Scap T C 9: 110,378,390 L431P probably damaging Het
Siglec1 T A 2: 131,073,361 I1437F possibly damaging Het
Skint1 T C 4: 112,028,333 probably null Het
Slc44a1 A G 4: 53,543,644 E396G probably damaging Het
Slc4a2 T C 5: 24,434,869 F521S probably damaging Het
Smarcc1 T A 9: 110,175,061 S394R probably damaging Het
Socs1 A G 16: 10,784,685 S63P probably benign Het
Sun1 T G 5: 139,225,333 S20A possibly damaging Het
Tac4 A T 11: 95,265,242 K50* probably null Het
Tcaf2 A G 6: 42,642,640 I151T probably damaging Het
Tcf4 T C 18: 69,681,769 V587A probably damaging Het
Ttc37 T A 13: 76,182,936 M1495K probably damaging Het
Ttn T A 2: 76,740,909 K24801* probably null Het
Tuba3b G T 6: 145,621,273 M413I possibly damaging Het
Ufl1 C T 4: 25,267,832 A280T possibly damaging Het
Ugt2b5 T A 5: 87,139,673 I212L probably benign Het
Umodl1 A G 17: 30,986,485 T685A probably benign Het
Uqcrc1 T A 9: 108,944,810 V183D probably damaging Het
Ush2a A G 1: 188,910,720 N4093S probably benign Het
Vmn1r167 C T 7: 23,505,228 S121N probably damaging Het
Vmn1r47 A G 6: 90,022,758 S291G possibly damaging Het
Vmn2r108 A G 17: 20,481,187 V17A probably benign Het
Vmn2r58 T A 7: 41,837,752 H573L probably benign Het
Xirp1 C T 9: 120,018,792 V342I probably damaging Het
Zfp467 G A 6: 48,439,029 H230Y probably damaging Het
Zfp595 T A 13: 67,316,401 K599N probably damaging Het
Zfp819 C A 7: 43,617,296 T401K probably benign Het
Other mutations in Zfp462
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Zfp462 APN 4 55011483 unclassified probably null
IGL00421:Zfp462 APN 4 55023576 missense probably benign 0.00
IGL00899:Zfp462 APN 4 55007732 missense probably damaging 1.00
IGL01549:Zfp462 APN 4 55013181 missense probably damaging 1.00
IGL01627:Zfp462 APN 4 55008912 missense possibly damaging 0.93
IGL01715:Zfp462 APN 4 55008586 missense probably benign 0.20
IGL01862:Zfp462 APN 4 55023441 missense probably damaging 1.00
IGL01878:Zfp462 APN 4 55010613 missense probably damaging 1.00
IGL01913:Zfp462 APN 4 55012138 missense probably benign 0.04
IGL02029:Zfp462 APN 4 55079395 splice site probably benign
IGL02338:Zfp462 APN 4 55010292 missense possibly damaging 0.88
IGL02552:Zfp462 APN 4 55010613 missense probably damaging 1.00
IGL02623:Zfp462 APN 4 55012986 missense probably damaging 1.00
IGL02750:Zfp462 APN 4 55060236 missense probably null 1.00
IGL02815:Zfp462 APN 4 55051303 missense probably damaging 1.00
IGL03204:Zfp462 APN 4 55080785 missense possibly damaging 0.80
FR4304:Zfp462 UTSW 4 55009757 unclassified probably benign
FR4304:Zfp462 UTSW 4 55009758 unclassified probably benign
FR4737:Zfp462 UTSW 4 55009758 unclassified probably benign
FR4737:Zfp462 UTSW 4 55009760 unclassified probably benign
FR4976:Zfp462 UTSW 4 55009760 unclassified probably benign
FR4976:Zfp462 UTSW 4 55009761 unclassified probably benign
P0035:Zfp462 UTSW 4 55009086 missense probably benign
R0052:Zfp462 UTSW 4 55011762 missense probably benign 0.03
R0143:Zfp462 UTSW 4 55023402 splice site probably benign
R0145:Zfp462 UTSW 4 55010529 missense probably damaging 1.00
R0315:Zfp462 UTSW 4 55079314 missense probably damaging 0.99
R0349:Zfp462 UTSW 4 55008768 missense probably benign
R0359:Zfp462 UTSW 4 55013689 missense probably damaging 1.00
R0413:Zfp462 UTSW 4 55010534 missense probably damaging 0.99
R0554:Zfp462 UTSW 4 55013689 missense probably damaging 1.00
R0616:Zfp462 UTSW 4 55011951 missense probably damaging 1.00
R0631:Zfp462 UTSW 4 55007563 start codon destroyed possibly damaging 0.60
R1086:Zfp462 UTSW 4 55013000 missense probably damaging 1.00
R1499:Zfp462 UTSW 4 55060046 missense probably damaging 1.00
R1509:Zfp462 UTSW 4 55007667 missense probably damaging 1.00
R1526:Zfp462 UTSW 4 55009002 missense probably benign
R1541:Zfp462 UTSW 4 55008928 missense possibly damaging 0.53
R1691:Zfp462 UTSW 4 55013489 missense possibly damaging 0.70
R1843:Zfp462 UTSW 4 55010010 missense possibly damaging 0.88
R2086:Zfp462 UTSW 4 55010830 missense probably damaging 1.00
R2109:Zfp462 UTSW 4 55008496 missense probably benign 0.00
R2148:Zfp462 UTSW 4 55013670 missense probably benign 0.01
R2179:Zfp462 UTSW 4 55009524 missense possibly damaging 0.73
R2325:Zfp462 UTSW 4 55013712 missense probably benign
R2352:Zfp462 UTSW 4 55008313 missense probably null
R2566:Zfp462 UTSW 4 55008522 missense probably benign 0.00
R3879:Zfp462 UTSW 4 55060095 missense probably damaging 1.00
R3969:Zfp462 UTSW 4 55012402 missense probably damaging 1.00
R4273:Zfp462 UTSW 4 55008411 missense probably benign 0.00
R4413:Zfp462 UTSW 4 55012672 missense probably damaging 0.99
R4510:Zfp462 UTSW 4 55008934 missense possibly damaging 0.86
R4511:Zfp462 UTSW 4 55008934 missense possibly damaging 0.86
R4609:Zfp462 UTSW 4 55011889 missense probably damaging 1.00
R4632:Zfp462 UTSW 4 55012981 missense probably damaging 1.00
R4649:Zfp462 UTSW 4 55009349 missense probably benign
R4682:Zfp462 UTSW 4 55011376 missense probably damaging 1.00
R4696:Zfp462 UTSW 4 55008612 missense probably benign
R4744:Zfp462 UTSW 4 55011598 missense probably damaging 1.00
R4747:Zfp462 UTSW 4 55013476 missense probably benign 0.00
R4819:Zfp462 UTSW 4 55060044 missense probably damaging 1.00
R4827:Zfp462 UTSW 4 55012213 missense probably damaging 1.00
R4854:Zfp462 UTSW 4 55010668 missense probably damaging 1.00
R4879:Zfp462 UTSW 4 55009444 missense probably benign 0.02
R4891:Zfp462 UTSW 4 55060055 missense probably damaging 1.00
R5118:Zfp462 UTSW 4 55010667 missense probably damaging 1.00
R5171:Zfp462 UTSW 4 55016986 splice site probably null
R5173:Zfp462 UTSW 4 55011115 missense probably damaging 0.99
R5221:Zfp462 UTSW 4 55016887 missense possibly damaging 0.86
R5268:Zfp462 UTSW 4 55012299 missense probably benign
R5314:Zfp462 UTSW 4 55013178 missense probably damaging 1.00
R5429:Zfp462 UTSW 4 55060077 missense probably damaging 1.00
R5518:Zfp462 UTSW 4 55009818 missense probably damaging 0.99
R5525:Zfp462 UTSW 4 55050281 missense possibly damaging 0.73
R5620:Zfp462 UTSW 4 55013464 missense probably benign 0.01
R5775:Zfp462 UTSW 4 55010590 missense probably damaging 0.99
R6126:Zfp462 UTSW 4 55023573 missense probably benign 0.01
R6280:Zfp462 UTSW 4 55010253 missense probably benign 0.00
R6325:Zfp462 UTSW 4 55080680 missense probably benign 0.04
R6542:Zfp462 UTSW 4 55023433 missense probably damaging 1.00
R6612:Zfp462 UTSW 4 55012324 unclassified probably null
R6663:Zfp462 UTSW 4 55008933 missense possibly damaging 0.53
R6872:Zfp462 UTSW 4 55012326 missense probably benign 0.01
R6889:Zfp462 UTSW 4 55007671 missense probably damaging 1.00
R6896:Zfp462 UTSW 4 55009544 missense possibly damaging 0.72
R6913:Zfp462 UTSW 4 55007775 missense probably benign 0.25
R6988:Zfp462 UTSW 4 55080716 missense probably benign 0.00
R7131:Zfp462 UTSW 4 55009380 missense probably benign
R7151:Zfp462 UTSW 4 55051271 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GAGTAGTTGCCTCTGTATCTCC -3'
(R):5'- GCTGAGGCACTAACCAACTC -3'

Sequencing Primer
(F):5'- CCCTCTCTGTTCCTTGATGG -3'
(R):5'- GCAGCAGCAGCACTACG -3'
Posted On2016-05-10