Incidental Mutation 'R4993:Mfap2'
ID384992
Institutional Source Beutler Lab
Gene Symbol Mfap2
Ensembl Gene ENSMUSG00000060572
Gene Namemicrofibrillar-associated protein 2
SynonymsMagp
MMRRC Submission 042587-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.209) question?
Stock #R4993 (G1)
Quality Score169
Status Not validated
Chromosome4
Chromosomal Location141010418-141015984 bp(+) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) T to C at 141015578 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Glutamine at position 186 (*186Q)
Ref Sequence ENSEMBL: ENSMUSP00000132711 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040222] [ENSMUST00000071977] [ENSMUST00000097816] [ENSMUST00000102491] [ENSMUST00000166376] [ENSMUST00000168157]
Predicted Effect probably benign
Transcript: ENSMUST00000040222
SMART Domains Protein: ENSMUSP00000037679
Gene: ENSMUSG00000040860

DomainStartEndE-ValueType
Pfam:Rootletin 1 173 6.1e-48 PFAM
low complexity region 190 217 N/A INTRINSIC
internal_repeat_2 298 315 1.08e-6 PROSPERO
low complexity region 329 350 N/A INTRINSIC
internal_repeat_3 363 393 5.38e-6 PROSPERO
internal_repeat_6 369 392 2.67e-5 PROSPERO
low complexity region 397 411 N/A INTRINSIC
low complexity region 412 430 N/A INTRINSIC
low complexity region 453 474 N/A INTRINSIC
low complexity region 624 643 N/A INTRINSIC
low complexity region 699 716 N/A INTRINSIC
low complexity region 845 875 N/A INTRINSIC
internal_repeat_4 886 904 2.67e-5 PROSPERO
internal_repeat_7 893 906 5.96e-5 PROSPERO
internal_repeat_2 893 910 1.08e-6 PROSPERO
internal_repeat_4 897 914 2.67e-5 PROSPERO
internal_repeat_1 912 937 1.97e-8 PROSPERO
internal_repeat_7 1028 1041 5.96e-5 PROSPERO
low complexity region 1107 1124 N/A INTRINSIC
internal_repeat_5 1138 1164 2.67e-5 PROSPERO
low complexity region 1190 1201 N/A INTRINSIC
low complexity region 1253 1269 N/A INTRINSIC
low complexity region 1270 1289 N/A INTRINSIC
low complexity region 1297 1309 N/A INTRINSIC
internal_repeat_6 1533 1556 2.67e-5 PROSPERO
low complexity region 1559 1576 N/A INTRINSIC
coiled coil region 1580 1707 N/A INTRINSIC
coiled coil region 1728 1832 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000071977
AA Change: *186Q
SMART Domains Protein: ENSMUSP00000071868
Gene: ENSMUSG00000060572
AA Change: *186Q

DomainStartEndE-ValueType
Pfam:MAGP 3 153 1.2e-62 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000097816
SMART Domains Protein: ENSMUSP00000095425
Gene: ENSMUSG00000040860

DomainStartEndE-ValueType
Pfam:Rootletin 1 173 6.1e-48 PFAM
low complexity region 190 217 N/A INTRINSIC
internal_repeat_2 298 315 1.08e-6 PROSPERO
low complexity region 329 350 N/A INTRINSIC
internal_repeat_3 363 393 5.38e-6 PROSPERO
internal_repeat_6 369 392 2.67e-5 PROSPERO
low complexity region 397 411 N/A INTRINSIC
low complexity region 412 430 N/A INTRINSIC
low complexity region 453 474 N/A INTRINSIC
low complexity region 624 643 N/A INTRINSIC
low complexity region 699 716 N/A INTRINSIC
low complexity region 845 875 N/A INTRINSIC
internal_repeat_4 886 904 2.67e-5 PROSPERO
internal_repeat_7 893 906 5.96e-5 PROSPERO
internal_repeat_2 893 910 1.08e-6 PROSPERO
internal_repeat_4 897 914 2.67e-5 PROSPERO
internal_repeat_1 912 937 1.97e-8 PROSPERO
internal_repeat_7 1028 1041 5.96e-5 PROSPERO
low complexity region 1107 1124 N/A INTRINSIC
internal_repeat_5 1138 1164 2.67e-5 PROSPERO
low complexity region 1190 1201 N/A INTRINSIC
low complexity region 1253 1269 N/A INTRINSIC
low complexity region 1270 1289 N/A INTRINSIC
low complexity region 1297 1309 N/A INTRINSIC
internal_repeat_6 1533 1556 2.67e-5 PROSPERO
low complexity region 1559 1576 N/A INTRINSIC
coiled coil region 1580 1707 N/A INTRINSIC
coiled coil region 1728 1832 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102491
SMART Domains Protein: ENSMUSP00000099549
Gene: ENSMUSG00000040860

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 77 93 N/A INTRINSIC
Pfam:Rootletin 158 336 9.7e-65 PFAM
low complexity region 354 381 N/A INTRINSIC
internal_repeat_2 462 479 1.77e-6 PROSPERO
low complexity region 493 514 N/A INTRINSIC
internal_repeat_3 527 557 8.63e-6 PROSPERO
internal_repeat_6 533 556 4.21e-5 PROSPERO
low complexity region 561 575 N/A INTRINSIC
low complexity region 576 594 N/A INTRINSIC
low complexity region 617 638 N/A INTRINSIC
low complexity region 788 807 N/A INTRINSIC
low complexity region 863 880 N/A INTRINSIC
low complexity region 1009 1039 N/A INTRINSIC
internal_repeat_4 1050 1068 4.21e-5 PROSPERO
internal_repeat_7 1057 1070 9.31e-5 PROSPERO
internal_repeat_2 1057 1074 1.77e-6 PROSPERO
internal_repeat_4 1061 1078 4.21e-5 PROSPERO
internal_repeat_1 1076 1101 3.36e-8 PROSPERO
internal_repeat_7 1192 1205 9.31e-5 PROSPERO
low complexity region 1271 1288 N/A INTRINSIC
internal_repeat_5 1302 1328 4.21e-5 PROSPERO
low complexity region 1354 1365 N/A INTRINSIC
low complexity region 1417 1433 N/A INTRINSIC
low complexity region 1434 1453 N/A INTRINSIC
low complexity region 1461 1473 N/A INTRINSIC
internal_repeat_6 1697 1720 4.21e-5 PROSPERO
low complexity region 1723 1740 N/A INTRINSIC
coiled coil region 1744 1871 N/A INTRINSIC
coiled coil region 1892 1996 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122846
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124286
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124506
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126973
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151455
Predicted Effect probably null
Transcript: ENSMUST00000166376
AA Change: *186Q
SMART Domains Protein: ENSMUSP00000132711
Gene: ENSMUSG00000060572
AA Change: *186Q

DomainStartEndE-ValueType
Pfam:MAGP 2 153 2e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168157
SMART Domains Protein: ENSMUSP00000126543
Gene: ENSMUSG00000040860

DomainStartEndE-ValueType
Pfam:Rootletin 1 173 6.1e-48 PFAM
low complexity region 190 217 N/A INTRINSIC
internal_repeat_2 298 315 1.08e-6 PROSPERO
low complexity region 329 350 N/A INTRINSIC
internal_repeat_3 363 393 5.38e-6 PROSPERO
internal_repeat_6 369 392 2.67e-5 PROSPERO
low complexity region 397 411 N/A INTRINSIC
low complexity region 412 430 N/A INTRINSIC
low complexity region 453 474 N/A INTRINSIC
low complexity region 624 643 N/A INTRINSIC
low complexity region 699 716 N/A INTRINSIC
low complexity region 845 875 N/A INTRINSIC
internal_repeat_4 886 904 2.67e-5 PROSPERO
internal_repeat_7 893 906 5.96e-5 PROSPERO
internal_repeat_2 893 910 1.08e-6 PROSPERO
internal_repeat_4 897 914 2.67e-5 PROSPERO
internal_repeat_1 912 937 1.97e-8 PROSPERO
internal_repeat_7 1028 1041 5.96e-5 PROSPERO
low complexity region 1107 1124 N/A INTRINSIC
internal_repeat_5 1138 1164 2.67e-5 PROSPERO
low complexity region 1190 1201 N/A INTRINSIC
low complexity region 1253 1269 N/A INTRINSIC
low complexity region 1270 1289 N/A INTRINSIC
low complexity region 1297 1309 N/A INTRINSIC
internal_repeat_6 1533 1556 2.67e-5 PROSPERO
low complexity region 1559 1576 N/A INTRINSIC
coiled coil region 1580 1707 N/A INTRINSIC
coiled coil region 1728 1832 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Microfibrillar-associated protein 2 is a major antigen of elastin-associated microfibrils and a candidate for involvement in the etiology of inherited connective tissue diseases. Four transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Sep 2008]
PHENOTYPE: Homozygotes for a knock-out allele show thrombocytopenia, delayed thrombotic occlusion following vessel injury, and prolonged bleeding from a tail vein incision. Homozygotes for a different knock-out allele exhibit marrow adipose tissue expansion, insulin resistance, and altered basal hematopoiesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
9130008F23Rik G T 17: 40,880,161 Q126K probably benign Het
Abca15 C A 7: 120,401,718 N1492K probably damaging Het
Afap1l2 C T 19: 56,918,040 D402N probably damaging Het
Akap11 A G 14: 78,512,968 F660L probably damaging Het
Bcl3 T C 7: 19,820,177 T89A probably benign Het
Bub1b T C 2: 118,636,770 I858T possibly damaging Het
Cdk19 A G 10: 40,476,218 D288G possibly damaging Het
Cyp2d34 T A 15: 82,618,329 D202V probably damaging Het
Dip2c T G 13: 9,575,223 Y584* probably null Het
Dpf3 A T 12: 83,331,861 probably null Het
Drp2 G A X: 134,441,316 R567H probably damaging Homo
Emid1 G T 11: 5,131,512 Q212K probably benign Het
Esm1 C T 13: 113,213,399 Q118* probably null Het
Fahd2a T G 2: 127,436,364 I308L probably benign Het
Fam208a T A 14: 27,429,114 W16R possibly damaging Het
Fanci T C 7: 79,435,378 *851Q probably null Het
Fastkd1 C A 2: 69,702,740 V428F probably damaging Het
Fat2 A T 11: 55,283,092 I2265N probably damaging Het
Gale C A 4: 135,966,860 H191Q probably damaging Het
Ghsr T A 3: 27,372,254 V153E possibly damaging Het
Gm10696 C T 3: 94,176,316 G63R probably damaging Het
Gpc6 A G 14: 117,624,539 N289S possibly damaging Het
Hoxb6 A T 11: 96,300,711 Y153F probably damaging Het
Ints3 T C 3: 90,415,507 T139A probably benign Het
Irf2bp2 A G 8: 126,592,671 S256P probably benign Het
Klf4 G T 4: 55,530,640 P148Q probably damaging Het
Loxl1 T G 9: 58,312,537 H117P probably damaging Het
Lpl A G 8: 68,895,793 K225E probably benign Het
Lrba T A 3: 86,360,037 V1678D probably damaging Het
Med1 A T 11: 98,163,904 F398Y probably damaging Het
Mfsd3 T C 15: 76,701,982 L105P probably damaging Het
Mlxip T G 5: 123,395,294 I122S probably damaging Het
Mmrn2 A T 14: 34,396,398 Y107F probably damaging Het
Mtg1 G T 7: 140,140,283 D88Y probably null Het
Mutyh T A 4: 116,817,935 S426R probably benign Het
Myo16 C T 8: 10,476,094 T878I probably damaging Het
Myo9a T A 9: 59,861,472 Y912* probably null Het
Ncor1 A C 11: 62,343,341 I669R probably damaging Het
Ndufs1 T C 1: 63,163,776 I210V probably benign Het
Nek9 A G 12: 85,310,420 C657R probably damaging Het
Noct C T 3: 51,250,021 T260I probably damaging Het
Nr1h4 A T 10: 89,498,180 M102K probably benign Het
Obscn G A 11: 59,124,761 R1054C possibly damaging Het
Olfr1124 T A 2: 87,435,152 F222I probably benign Het
Olfr352 C A 2: 36,869,988 Q141K probably benign Het
Olfr47 A G 6: 43,236,456 M283V possibly damaging Het
Olfr501-ps1 G A 7: 108,508,243 M62I probably damaging Het
Olfr615 T A 7: 103,561,317 I280N possibly damaging Het
Olfr619 A T 7: 103,603,656 M1L probably benign Het
Otol1 C A 3: 70,018,878 Q129K probably benign Het
Otx1 A T 11: 21,998,532 probably null Het
Pcdhac2 C A 18: 37,146,251 N761K probably damaging Het
Pde1c A T 6: 56,150,624 M452K probably damaging Het
Phkg2 T C 7: 127,573,941 Y24H probably damaging Het
Pigr G A 1: 130,841,817 D122N probably benign Het
Prg4 C T 1: 150,460,681 C97Y probably damaging Het
Ptdss1 T C 13: 66,945,288 V64A probably benign Het
Ralgapa2 T C 2: 146,447,311 K324E probably damaging Het
Rfx5 G A 3: 94,955,815 V73I probably benign Het
Riiad1 T C 3: 94,472,863 T42A probably benign Het
Rims2 T C 15: 39,454,445 V640A possibly damaging Het
Rnpep G T 1: 135,263,032 S592Y possibly damaging Het
Scap T C 9: 110,378,390 L431P probably damaging Het
Siglec1 T A 2: 131,073,361 I1437F possibly damaging Het
Skint1 T C 4: 112,028,333 probably null Het
Slc44a1 A G 4: 53,543,644 E396G probably damaging Het
Slc4a2 T C 5: 24,434,869 F521S probably damaging Het
Smarcc1 T A 9: 110,175,061 S394R probably damaging Het
Socs1 A G 16: 10,784,685 S63P probably benign Het
Sun1 T G 5: 139,225,333 S20A possibly damaging Het
Tac4 A T 11: 95,265,242 K50* probably null Het
Tcaf2 A G 6: 42,642,640 I151T probably damaging Het
Tcf4 T C 18: 69,681,769 V587A probably damaging Het
Ttc37 T A 13: 76,182,936 M1495K probably damaging Het
Ttn T A 2: 76,740,909 K24801* probably null Het
Tuba3b G T 6: 145,621,273 M413I possibly damaging Het
Ufl1 C T 4: 25,267,832 A280T possibly damaging Het
Ugt2b5 T A 5: 87,139,673 I212L probably benign Het
Umodl1 A G 17: 30,986,485 T685A probably benign Het
Uqcrc1 T A 9: 108,944,810 V183D probably damaging Het
Ush2a A G 1: 188,910,720 N4093S probably benign Het
Vmn1r167 C T 7: 23,505,228 S121N probably damaging Het
Vmn1r47 A G 6: 90,022,758 S291G possibly damaging Het
Vmn2r108 A G 17: 20,481,187 V17A probably benign Het
Vmn2r58 T A 7: 41,837,752 H573L probably benign Het
Xirp1 C T 9: 120,018,792 V342I probably damaging Het
Zfp462 A G 4: 55,051,204 M2226V possibly damaging Het
Zfp467 G A 6: 48,439,029 H230Y probably damaging Het
Zfp595 T A 13: 67,316,401 K599N probably damaging Het
Zfp819 C A 7: 43,617,296 T401K probably benign Het
Other mutations in Mfap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01318:Mfap2 APN 4 141015545 missense possibly damaging 0.82
IGL02422:Mfap2 APN 4 141014224 missense probably benign 0.02
R0149:Mfap2 UTSW 4 141014983 missense probably damaging 1.00
R0361:Mfap2 UTSW 4 141014983 missense probably damaging 1.00
R0545:Mfap2 UTSW 4 141014185 unclassified probably benign
R3981:Mfap2 UTSW 4 141014243 missense possibly damaging 0.80
R3983:Mfap2 UTSW 4 141014243 missense possibly damaging 0.80
R5019:Mfap2 UTSW 4 141015258 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGGAATATGTGCCCAAACC -3'
(R):5'- AGACTGGACAGTTAGGAGCC -3'

Sequencing Primer
(F):5'- AACCCACATGCAGGCTGG -3'
(R):5'- TTAGGAGCCCCCACTTAAGGATG -3'
Posted On2016-05-10