Incidental Mutation 'R4993:Zfp467'
ID385001
Institutional Source Beutler Lab
Gene Symbol Zfp467
Ensembl Gene ENSMUSG00000068551
Gene Namezinc finger protein 467
SynonymsEZI, MNCb-3350, 1190001I08Rik
MMRRC Submission 042587-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.178) question?
Stock #R4993 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location48427697-48445825 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 48439029 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 230 (H230Y)
Ref Sequence ENSEMBL: ENSMUSP00000110208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101443] [ENSMUST00000114556] [ENSMUST00000114558] [ENSMUST00000114559] [ENSMUST00000114560] [ENSMUST00000114561] [ENSMUST00000114563] [ENSMUST00000114564] [ENSMUST00000114566] [ENSMUST00000141449]
Predicted Effect probably benign
Transcript: ENSMUST00000101443
Predicted Effect probably benign
Transcript: ENSMUST00000114556
Predicted Effect probably benign
Transcript: ENSMUST00000114558
Predicted Effect probably benign
Transcript: ENSMUST00000114559
Predicted Effect probably damaging
Transcript: ENSMUST00000114560
AA Change: H230Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110207
Gene: ENSMUSG00000068551
AA Change: H230Y

DomainStartEndE-ValueType
low complexity region 98 110 N/A INTRINSIC
ZnF_C2H2 160 182 1.26e-2 SMART
ZnF_C2H2 188 210 1.67e-2 SMART
ZnF_C2H2 216 238 2.12e-4 SMART
ZnF_C2H2 244 266 5.9e-3 SMART
ZnF_C2H2 272 294 1.47e-3 SMART
ZnF_C2H2 300 322 1.82e-3 SMART
ZnF_C2H2 355 377 9.58e-3 SMART
ZnF_C2H2 430 452 7.26e-3 SMART
ZnF_C2H2 458 480 1.56e-2 SMART
ZnF_C2H2 486 508 1.18e-2 SMART
ZnF_C2H2 514 536 3.11e-2 SMART
ZnF_C2H2 542 564 2.43e-4 SMART
low complexity region 567 585 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114561
AA Change: H230Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110208
Gene: ENSMUSG00000068551
AA Change: H230Y

DomainStartEndE-ValueType
low complexity region 98 110 N/A INTRINSIC
ZnF_C2H2 160 182 1.26e-2 SMART
ZnF_C2H2 188 210 1.67e-2 SMART
ZnF_C2H2 216 238 2.12e-4 SMART
ZnF_C2H2 244 266 5.9e-3 SMART
ZnF_C2H2 272 294 1.47e-3 SMART
ZnF_C2H2 300 322 1.82e-3 SMART
ZnF_C2H2 355 377 9.58e-3 SMART
ZnF_C2H2 430 452 7.26e-3 SMART
ZnF_C2H2 458 480 1.56e-2 SMART
ZnF_C2H2 486 508 1.18e-2 SMART
ZnF_C2H2 514 536 3.11e-2 SMART
ZnF_C2H2 542 564 2.43e-4 SMART
low complexity region 567 585 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114563
Predicted Effect probably benign
Transcript: ENSMUST00000114564
Predicted Effect probably benign
Transcript: ENSMUST00000114566
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140198
Predicted Effect probably benign
Transcript: ENSMUST00000141449
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger protein whose function has not yet been elucidated in humans. However, the mouse ortholog of this protein enhances adipocyte differentiation and suppresses osteoblast differentiation in bone marrow. The mouse protein also is a transcription factor for several genes and can help recruit histone deacetylase complexes. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
9130008F23Rik G T 17: 40,880,161 Q126K probably benign Het
Abca15 C A 7: 120,401,718 N1492K probably damaging Het
Afap1l2 C T 19: 56,918,040 D402N probably damaging Het
Akap11 A G 14: 78,512,968 F660L probably damaging Het
Bcl3 T C 7: 19,820,177 T89A probably benign Het
Bub1b T C 2: 118,636,770 I858T possibly damaging Het
Cdk19 A G 10: 40,476,218 D288G possibly damaging Het
Cyp2d34 T A 15: 82,618,329 D202V probably damaging Het
Dip2c T G 13: 9,575,223 Y584* probably null Het
Dpf3 A T 12: 83,331,861 probably null Het
Drp2 G A X: 134,441,316 R567H probably damaging Homo
Emid1 G T 11: 5,131,512 Q212K probably benign Het
Esm1 C T 13: 113,213,399 Q118* probably null Het
Fahd2a T G 2: 127,436,364 I308L probably benign Het
Fam208a T A 14: 27,429,114 W16R possibly damaging Het
Fanci T C 7: 79,435,378 *851Q probably null Het
Fastkd1 C A 2: 69,702,740 V428F probably damaging Het
Fat2 A T 11: 55,283,092 I2265N probably damaging Het
Gale C A 4: 135,966,860 H191Q probably damaging Het
Ghsr T A 3: 27,372,254 V153E possibly damaging Het
Gm10696 C T 3: 94,176,316 G63R probably damaging Het
Gpc6 A G 14: 117,624,539 N289S possibly damaging Het
Hoxb6 A T 11: 96,300,711 Y153F probably damaging Het
Ints3 T C 3: 90,415,507 T139A probably benign Het
Irf2bp2 A G 8: 126,592,671 S256P probably benign Het
Klf4 G T 4: 55,530,640 P148Q probably damaging Het
Loxl1 T G 9: 58,312,537 H117P probably damaging Het
Lpl A G 8: 68,895,793 K225E probably benign Het
Lrba T A 3: 86,360,037 V1678D probably damaging Het
Med1 A T 11: 98,163,904 F398Y probably damaging Het
Mfap2 T C 4: 141,015,578 *186Q probably null Het
Mfsd3 T C 15: 76,701,982 L105P probably damaging Het
Mlxip T G 5: 123,395,294 I122S probably damaging Het
Mmrn2 A T 14: 34,396,398 Y107F probably damaging Het
Mtg1 G T 7: 140,140,283 D88Y probably null Het
Mutyh T A 4: 116,817,935 S426R probably benign Het
Myo16 C T 8: 10,476,094 T878I probably damaging Het
Myo9a T A 9: 59,861,472 Y912* probably null Het
Ncor1 A C 11: 62,343,341 I669R probably damaging Het
Ndufs1 T C 1: 63,163,776 I210V probably benign Het
Nek9 A G 12: 85,310,420 C657R probably damaging Het
Noct C T 3: 51,250,021 T260I probably damaging Het
Nr1h4 A T 10: 89,498,180 M102K probably benign Het
Obscn G A 11: 59,124,761 R1054C possibly damaging Het
Olfr1124 T A 2: 87,435,152 F222I probably benign Het
Olfr352 C A 2: 36,869,988 Q141K probably benign Het
Olfr47 A G 6: 43,236,456 M283V possibly damaging Het
Olfr501-ps1 G A 7: 108,508,243 M62I probably damaging Het
Olfr615 T A 7: 103,561,317 I280N possibly damaging Het
Olfr619 A T 7: 103,603,656 M1L probably benign Het
Otol1 C A 3: 70,018,878 Q129K probably benign Het
Otx1 A T 11: 21,998,532 probably null Het
Pcdhac2 C A 18: 37,146,251 N761K probably damaging Het
Pde1c A T 6: 56,150,624 M452K probably damaging Het
Phkg2 T C 7: 127,573,941 Y24H probably damaging Het
Pigr G A 1: 130,841,817 D122N probably benign Het
Prg4 C T 1: 150,460,681 C97Y probably damaging Het
Ptdss1 T C 13: 66,945,288 V64A probably benign Het
Ralgapa2 T C 2: 146,447,311 K324E probably damaging Het
Rfx5 G A 3: 94,955,815 V73I probably benign Het
Riiad1 T C 3: 94,472,863 T42A probably benign Het
Rims2 T C 15: 39,454,445 V640A possibly damaging Het
Rnpep G T 1: 135,263,032 S592Y possibly damaging Het
Scap T C 9: 110,378,390 L431P probably damaging Het
Siglec1 T A 2: 131,073,361 I1437F possibly damaging Het
Skint1 T C 4: 112,028,333 probably null Het
Slc44a1 A G 4: 53,543,644 E396G probably damaging Het
Slc4a2 T C 5: 24,434,869 F521S probably damaging Het
Smarcc1 T A 9: 110,175,061 S394R probably damaging Het
Socs1 A G 16: 10,784,685 S63P probably benign Het
Sun1 T G 5: 139,225,333 S20A possibly damaging Het
Tac4 A T 11: 95,265,242 K50* probably null Het
Tcaf2 A G 6: 42,642,640 I151T probably damaging Het
Tcf4 T C 18: 69,681,769 V587A probably damaging Het
Ttc37 T A 13: 76,182,936 M1495K probably damaging Het
Ttn T A 2: 76,740,909 K24801* probably null Het
Tuba3b G T 6: 145,621,273 M413I possibly damaging Het
Ufl1 C T 4: 25,267,832 A280T possibly damaging Het
Ugt2b5 T A 5: 87,139,673 I212L probably benign Het
Umodl1 A G 17: 30,986,485 T685A probably benign Het
Uqcrc1 T A 9: 108,944,810 V183D probably damaging Het
Ush2a A G 1: 188,910,720 N4093S probably benign Het
Vmn1r167 C T 7: 23,505,228 S121N probably damaging Het
Vmn1r47 A G 6: 90,022,758 S291G possibly damaging Het
Vmn2r108 A G 17: 20,481,187 V17A probably benign Het
Vmn2r58 T A 7: 41,837,752 H573L probably benign Het
Xirp1 C T 9: 120,018,792 V342I probably damaging Het
Zfp462 A G 4: 55,051,204 M2226V possibly damaging Het
Zfp595 T A 13: 67,316,401 K599N probably damaging Het
Zfp819 C A 7: 43,617,296 T401K probably benign Het
Other mutations in Zfp467
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0166:Zfp467 UTSW 6 48438681 missense probably benign 0.00
R0234:Zfp467 UTSW 6 48438755 missense probably damaging 1.00
R0234:Zfp467 UTSW 6 48438755 missense probably damaging 1.00
R1509:Zfp467 UTSW 6 48438687 missense possibly damaging 0.95
R1517:Zfp467 UTSW 6 48438236 missense probably damaging 1.00
R1656:Zfp467 UTSW 6 48439079 missense possibly damaging 0.87
R2131:Zfp467 UTSW 6 48442661 missense probably damaging 0.98
R2912:Zfp467 UTSW 6 48439076 missense possibly damaging 0.95
R4696:Zfp467 UTSW 6 48439357 unclassified probably benign
R4714:Zfp467 UTSW 6 48427817 missense unknown
R7038:Zfp467 UTSW 6 48438138 missense probably damaging 1.00
R7224:Zfp467 UTSW 6 48444969 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCAGATGCGTCTTCTTGCG -3'
(R):5'- CGATCCCTGAGAAGCCTTATGG -3'

Sequencing Primer
(F):5'- CAGATGCGTCTTCTTGCGGAAAC -3'
(R):5'- CGTTTCCGGGATCAGCTAAC -3'
Posted On2016-05-10