Incidental Mutation 'R4993:Lpl'
ID385020
Institutional Source Beutler Lab
Gene Symbol Lpl
Ensembl Gene ENSMUSG00000015568
Gene Namelipoprotein lipase
SynonymsO 1-4-5
MMRRC Submission 042587-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4993 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location68880491-68907448 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 68895793 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 225 (K225E)
Ref Sequence ENSEMBL: ENSMUSP00000132259 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015712] [ENSMUST00000168401]
Predicted Effect probably benign
Transcript: ENSMUST00000015712
AA Change: K225E

PolyPhen 2 Score 0.230 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000015712
Gene: ENSMUSG00000015568
AA Change: K225E

DomainStartEndE-ValueType
Pfam:Lipase 19 338 7.8e-133 PFAM
LH2 341 465 2.65e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168401
AA Change: K225E

PolyPhen 2 Score 0.230 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000132259
Gene: ENSMUSG00000015568
AA Change: K225E

DomainStartEndE-ValueType
Pfam:Lipase 19 338 1.1e-117 PFAM
Pfam:Abhydrolase_6 76 264 3e-10 PFAM
LH2 341 465 2.65e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169749
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] LPL encodes lipoprotein lipase, which is expressed in heart, muscle, and adipose tissue. LPL functions as a homodimer, and has the dual functions of triglyceride hydrolase and ligand/bridging factor for receptor-mediated lipoprotein uptake. Severe mutations that cause LPL deficiency result in type I hyperlipoproteinemia, while less extreme mutations in LPL are linked to many disorders of lipoprotein metabolism. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations become cyanotic and die within 2 days of birth due to chylomicron engorgement of capillaries. Mutants show hypertriglyceridemia and reduced fat stores. Heterozygotes show 1.5-2-fold elevated triglyceride levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
9130008F23Rik G T 17: 40,880,161 Q126K probably benign Het
Abca15 C A 7: 120,401,718 N1492K probably damaging Het
Afap1l2 C T 19: 56,918,040 D402N probably damaging Het
Akap11 A G 14: 78,512,968 F660L probably damaging Het
Bcl3 T C 7: 19,820,177 T89A probably benign Het
Bub1b T C 2: 118,636,770 I858T possibly damaging Het
Cdk19 A G 10: 40,476,218 D288G possibly damaging Het
Cyp2d34 T A 15: 82,618,329 D202V probably damaging Het
Dip2c T G 13: 9,575,223 Y584* probably null Het
Dpf3 A T 12: 83,331,861 probably null Het
Drp2 G A X: 134,441,316 R567H probably damaging Homo
Emid1 G T 11: 5,131,512 Q212K probably benign Het
Esm1 C T 13: 113,213,399 Q118* probably null Het
Fahd2a T G 2: 127,436,364 I308L probably benign Het
Fam208a T A 14: 27,429,114 W16R possibly damaging Het
Fanci T C 7: 79,435,378 *851Q probably null Het
Fastkd1 C A 2: 69,702,740 V428F probably damaging Het
Fat2 A T 11: 55,283,092 I2265N probably damaging Het
Gale C A 4: 135,966,860 H191Q probably damaging Het
Ghsr T A 3: 27,372,254 V153E possibly damaging Het
Gm10696 C T 3: 94,176,316 G63R probably damaging Het
Gpc6 A G 14: 117,624,539 N289S possibly damaging Het
Hoxb6 A T 11: 96,300,711 Y153F probably damaging Het
Ints3 T C 3: 90,415,507 T139A probably benign Het
Irf2bp2 A G 8: 126,592,671 S256P probably benign Het
Klf4 G T 4: 55,530,640 P148Q probably damaging Het
Loxl1 T G 9: 58,312,537 H117P probably damaging Het
Lrba T A 3: 86,360,037 V1678D probably damaging Het
Med1 A T 11: 98,163,904 F398Y probably damaging Het
Mfap2 T C 4: 141,015,578 *186Q probably null Het
Mfsd3 T C 15: 76,701,982 L105P probably damaging Het
Mlxip T G 5: 123,395,294 I122S probably damaging Het
Mmrn2 A T 14: 34,396,398 Y107F probably damaging Het
Mtg1 G T 7: 140,140,283 D88Y probably null Het
Mutyh T A 4: 116,817,935 S426R probably benign Het
Myo16 C T 8: 10,476,094 T878I probably damaging Het
Myo9a T A 9: 59,861,472 Y912* probably null Het
Ncor1 A C 11: 62,343,341 I669R probably damaging Het
Ndufs1 T C 1: 63,163,776 I210V probably benign Het
Nek9 A G 12: 85,310,420 C657R probably damaging Het
Noct C T 3: 51,250,021 T260I probably damaging Het
Nr1h4 A T 10: 89,498,180 M102K probably benign Het
Obscn G A 11: 59,124,761 R1054C possibly damaging Het
Olfr1124 T A 2: 87,435,152 F222I probably benign Het
Olfr352 C A 2: 36,869,988 Q141K probably benign Het
Olfr47 A G 6: 43,236,456 M283V possibly damaging Het
Olfr501-ps1 G A 7: 108,508,243 M62I probably damaging Het
Olfr615 T A 7: 103,561,317 I280N possibly damaging Het
Olfr619 A T 7: 103,603,656 M1L probably benign Het
Otol1 C A 3: 70,018,878 Q129K probably benign Het
Otx1 A T 11: 21,998,532 probably null Het
Pcdhac2 C A 18: 37,146,251 N761K probably damaging Het
Pde1c A T 6: 56,150,624 M452K probably damaging Het
Phkg2 T C 7: 127,573,941 Y24H probably damaging Het
Pigr G A 1: 130,841,817 D122N probably benign Het
Prg4 C T 1: 150,460,681 C97Y probably damaging Het
Ptdss1 T C 13: 66,945,288 V64A probably benign Het
Ralgapa2 T C 2: 146,447,311 K324E probably damaging Het
Rfx5 G A 3: 94,955,815 V73I probably benign Het
Riiad1 T C 3: 94,472,863 T42A probably benign Het
Rims2 T C 15: 39,454,445 V640A possibly damaging Het
Rnpep G T 1: 135,263,032 S592Y possibly damaging Het
Scap T C 9: 110,378,390 L431P probably damaging Het
Siglec1 T A 2: 131,073,361 I1437F possibly damaging Het
Skint1 T C 4: 112,028,333 probably null Het
Slc44a1 A G 4: 53,543,644 E396G probably damaging Het
Slc4a2 T C 5: 24,434,869 F521S probably damaging Het
Smarcc1 T A 9: 110,175,061 S394R probably damaging Het
Socs1 A G 16: 10,784,685 S63P probably benign Het
Sun1 T G 5: 139,225,333 S20A possibly damaging Het
Tac4 A T 11: 95,265,242 K50* probably null Het
Tcaf2 A G 6: 42,642,640 I151T probably damaging Het
Tcf4 T C 18: 69,681,769 V587A probably damaging Het
Ttc37 T A 13: 76,182,936 M1495K probably damaging Het
Ttn T A 2: 76,740,909 K24801* probably null Het
Tuba3b G T 6: 145,621,273 M413I possibly damaging Het
Ufl1 C T 4: 25,267,832 A280T possibly damaging Het
Ugt2b5 T A 5: 87,139,673 I212L probably benign Het
Umodl1 A G 17: 30,986,485 T685A probably benign Het
Uqcrc1 T A 9: 108,944,810 V183D probably damaging Het
Ush2a A G 1: 188,910,720 N4093S probably benign Het
Vmn1r167 C T 7: 23,505,228 S121N probably damaging Het
Vmn1r47 A G 6: 90,022,758 S291G possibly damaging Het
Vmn2r108 A G 17: 20,481,187 V17A probably benign Het
Vmn2r58 T A 7: 41,837,752 H573L probably benign Het
Xirp1 C T 9: 120,018,792 V342I probably damaging Het
Zfp462 A G 4: 55,051,204 M2226V possibly damaging Het
Zfp467 G A 6: 48,439,029 H230Y probably damaging Het
Zfp595 T A 13: 67,316,401 K599N probably damaging Het
Zfp819 C A 7: 43,617,296 T401K probably benign Het
Other mutations in Lpl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00806:Lpl APN 8 68902366 missense probably benign 0.00
IGL01161:Lpl APN 8 68892625 nonsense probably null
IGL01370:Lpl APN 8 68887568 missense possibly damaging 0.92
IGL01420:Lpl APN 8 68887433 splice site probably benign
IGL02034:Lpl APN 8 68880772 missense possibly damaging 0.64
IGL02227:Lpl APN 8 68895800 missense probably damaging 0.99
IGL02949:Lpl APN 8 68892748 missense probably damaging 1.00
IGL03237:Lpl APN 8 68894726 missense possibly damaging 0.90
Bensadoun UTSW 8 68896807 missense probably benign 0.03
R0064:Lpl UTSW 8 68892704 missense probably damaging 1.00
R0064:Lpl UTSW 8 68892704 missense probably damaging 1.00
R0490:Lpl UTSW 8 68896691 missense probably damaging 0.98
R1252:Lpl UTSW 8 68892659 missense probably benign 0.03
R1331:Lpl UTSW 8 68896629 missense probably damaging 0.99
R1376:Lpl UTSW 8 68887598 missense probably damaging 1.00
R1376:Lpl UTSW 8 68887598 missense probably damaging 1.00
R1444:Lpl UTSW 8 68892747 missense probably damaging 0.99
R1722:Lpl UTSW 8 68896602 frame shift probably null
R1826:Lpl UTSW 8 68902291 missense possibly damaging 0.62
R1867:Lpl UTSW 8 68896602 frame shift probably null
R1874:Lpl UTSW 8 68896619 missense probably damaging 1.00
R1970:Lpl UTSW 8 68896802 nonsense probably null
R2401:Lpl UTSW 8 68901243 missense possibly damaging 0.52
R2516:Lpl UTSW 8 68887518 missense probably benign 0.00
R2850:Lpl UTSW 8 68899512 nonsense probably null
R4688:Lpl UTSW 8 68899425 missense probably damaging 1.00
R4773:Lpl UTSW 8 68896751 missense probably damaging 1.00
R4962:Lpl UTSW 8 68894693 missense probably damaging 1.00
R5343:Lpl UTSW 8 68895737 missense probably damaging 1.00
R6018:Lpl UTSW 8 68901288 missense probably benign
R6082:Lpl UTSW 8 68896649 missense probably damaging 0.98
R6137:Lpl UTSW 8 68892747 missense probably damaging 0.99
R6589:Lpl UTSW 8 68896807 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGCAAGGATTAAATGTACTGCAGAC -3'
(R):5'- CCACAAGTGTGTATACTGAAACCAC -3'

Sequencing Primer
(F):5'- GCAGACTTTAAAAATCCATGGGACTC -3'
(R):5'- CTGAAACCACATATTGTAGAGATAGG -3'
Posted On2016-05-10