Incidental Mutation 'R4993:Fat2'
ID385033
Institutional Source Beutler Lab
Gene Symbol Fat2
Ensembl Gene ENSMUSG00000055333
Gene NameFAT atypical cadherin 2
SynonymsmKIAA0811, LOC245827, Fath2, EMI2
MMRRC Submission 042587-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4993 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location55250609-55336564 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 55283092 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 2265 (I2265N)
Ref Sequence ENSEMBL: ENSMUSP00000104492 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068853] [ENSMUST00000108864]
Predicted Effect probably damaging
Transcript: ENSMUST00000068853
AA Change: I2265N

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000067556
Gene: ENSMUSG00000055333
AA Change: I2265N

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
CA 55 146 3.65e-4 SMART
CA 170 254 3.99e-10 SMART
low complexity region 337 348 N/A INTRINSIC
CA 384 456 5.11e-8 SMART
CA 480 562 2.71e-21 SMART
CA 586 664 1.12e-2 SMART
CA 737 818 1.69e-22 SMART
CA 842 923 9.59e-22 SMART
CA 947 1028 7.39e-14 SMART
CA 1054 1135 3.74e-24 SMART
CA 1159 1240 1.84e-23 SMART
CA 1266 1342 8.9e-8 SMART
CA 1368 1446 7.4e-5 SMART
CA 1470 1553 1.98e-14 SMART
CA 1577 1658 6.84e-18 SMART
CA 1682 1756 2.76e-13 SMART
CA 1787 1870 1.49e-18 SMART
CA 1894 1966 1.11e-1 SMART
CA 1990 2068 2.4e-13 SMART
CA 2092 2171 3.42e-18 SMART
CA 2190 2270 1.9e-16 SMART
CA 2294 2377 1.49e-27 SMART
CA 2401 2479 8.31e-8 SMART
CA 2503 2583 6.48e-19 SMART
CA 2607 2690 1.53e-6 SMART
CA 2714 2797 3e-14 SMART
CA 2821 2906 5.85e-26 SMART
CA 2930 3011 4.58e-19 SMART
CA 3035 3113 2.1e-27 SMART
CA 3137 3218 9.67e-18 SMART
CA 3243 3321 1.92e-12 SMART
CA 3345 3426 4.04e-29 SMART
CA 3450 3531 1.79e-12 SMART
CA 3555 3629 9.3e-2 SMART
LamG 3794 3923 1.77e-28 SMART
EGF 3952 3986 6.5e-5 SMART
EGF 3991 4024 1.6e-4 SMART
transmembrane domain 4051 4073 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108864
AA Change: I2265N

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000104492
Gene: ENSMUSG00000055333
AA Change: I2265N

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
CA 55 146 3.65e-4 SMART
CA 170 254 3.99e-10 SMART
low complexity region 337 348 N/A INTRINSIC
CA 384 456 5.11e-8 SMART
CA 480 562 2.71e-21 SMART
CA 586 664 1.12e-2 SMART
CA 737 818 1.69e-22 SMART
CA 842 923 9.59e-22 SMART
CA 947 1028 7.39e-14 SMART
CA 1054 1135 3.74e-24 SMART
CA 1159 1240 1.84e-23 SMART
CA 1266 1342 8.9e-8 SMART
CA 1368 1446 7.4e-5 SMART
CA 1470 1553 1.98e-14 SMART
CA 1577 1658 6.84e-18 SMART
CA 1682 1756 2.76e-13 SMART
CA 1787 1870 1.49e-18 SMART
CA 1894 1966 1.11e-1 SMART
CA 1990 2068 2.4e-13 SMART
CA 2092 2171 3.42e-18 SMART
CA 2190 2270 1.9e-16 SMART
CA 2294 2377 1.49e-27 SMART
CA 2401 2479 8.31e-8 SMART
CA 2503 2583 6.48e-19 SMART
CA 2607 2690 1.53e-6 SMART
CA 2714 2797 3e-14 SMART
CA 2821 2906 5.85e-26 SMART
CA 2930 3011 4.58e-19 SMART
CA 3035 3113 2.1e-27 SMART
CA 3137 3218 9.67e-18 SMART
CA 3243 3321 1.92e-12 SMART
CA 3345 3426 4.04e-29 SMART
CA 3450 3531 1.79e-12 SMART
CA 3555 3629 9.3e-2 SMART
LamG 3794 3923 1.77e-28 SMART
EGF 3952 3986 6.5e-5 SMART
EGF 3991 4024 1.6e-4 SMART
transmembrane domain 4051 4073 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is the second identified human homolog of the Drosophila fat gene, which encodes a tumor suppressor essential for controlling cell proliferation during Drosophila development. The gene product is a member of the cadherin superfamily, a group of integral membrane proteins characterized by the presence of cadherin-type repeats. In addition to containing 34 tandem cadherin-type repeats, the gene product has two epidermal growth factor (EGF)-like repeats and one laminin G domain. This protein most likely functions as a cell adhesion molecule, controlling cell proliferation and playing an important role in cerebellum development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are healthy, fertile and overtly normal, with no apparent defects in the development of red blood cells or platelets. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
9130008F23Rik G T 17: 40,880,161 Q126K probably benign Het
Abca15 C A 7: 120,401,718 N1492K probably damaging Het
Afap1l2 C T 19: 56,918,040 D402N probably damaging Het
Akap11 A G 14: 78,512,968 F660L probably damaging Het
Bcl3 T C 7: 19,820,177 T89A probably benign Het
Bub1b T C 2: 118,636,770 I858T possibly damaging Het
Cdk19 A G 10: 40,476,218 D288G possibly damaging Het
Cyp2d34 T A 15: 82,618,329 D202V probably damaging Het
Dip2c T G 13: 9,575,223 Y584* probably null Het
Dpf3 A T 12: 83,331,861 probably null Het
Drp2 G A X: 134,441,316 R567H probably damaging Homo
Emid1 G T 11: 5,131,512 Q212K probably benign Het
Esm1 C T 13: 113,213,399 Q118* probably null Het
Fahd2a T G 2: 127,436,364 I308L probably benign Het
Fam208a T A 14: 27,429,114 W16R possibly damaging Het
Fanci T C 7: 79,435,378 *851Q probably null Het
Fastkd1 C A 2: 69,702,740 V428F probably damaging Het
Gale C A 4: 135,966,860 H191Q probably damaging Het
Ghsr T A 3: 27,372,254 V153E possibly damaging Het
Gm10696 C T 3: 94,176,316 G63R probably damaging Het
Gpc6 A G 14: 117,624,539 N289S possibly damaging Het
Hoxb6 A T 11: 96,300,711 Y153F probably damaging Het
Ints3 T C 3: 90,415,507 T139A probably benign Het
Irf2bp2 A G 8: 126,592,671 S256P probably benign Het
Klf4 G T 4: 55,530,640 P148Q probably damaging Het
Loxl1 T G 9: 58,312,537 H117P probably damaging Het
Lpl A G 8: 68,895,793 K225E probably benign Het
Lrba T A 3: 86,360,037 V1678D probably damaging Het
Med1 A T 11: 98,163,904 F398Y probably damaging Het
Mfap2 T C 4: 141,015,578 *186Q probably null Het
Mfsd3 T C 15: 76,701,982 L105P probably damaging Het
Mlxip T G 5: 123,395,294 I122S probably damaging Het
Mmrn2 A T 14: 34,396,398 Y107F probably damaging Het
Mtg1 G T 7: 140,140,283 D88Y probably null Het
Mutyh T A 4: 116,817,935 S426R probably benign Het
Myo16 C T 8: 10,476,094 T878I probably damaging Het
Myo9a T A 9: 59,861,472 Y912* probably null Het
Ncor1 A C 11: 62,343,341 I669R probably damaging Het
Ndufs1 T C 1: 63,163,776 I210V probably benign Het
Nek9 A G 12: 85,310,420 C657R probably damaging Het
Noct C T 3: 51,250,021 T260I probably damaging Het
Nr1h4 A T 10: 89,498,180 M102K probably benign Het
Obscn G A 11: 59,124,761 R1054C possibly damaging Het
Olfr1124 T A 2: 87,435,152 F222I probably benign Het
Olfr352 C A 2: 36,869,988 Q141K probably benign Het
Olfr47 A G 6: 43,236,456 M283V possibly damaging Het
Olfr501-ps1 G A 7: 108,508,243 M62I probably damaging Het
Olfr615 T A 7: 103,561,317 I280N possibly damaging Het
Olfr619 A T 7: 103,603,656 M1L probably benign Het
Otol1 C A 3: 70,018,878 Q129K probably benign Het
Otx1 A T 11: 21,998,532 probably null Het
Pcdhac2 C A 18: 37,146,251 N761K probably damaging Het
Pde1c A T 6: 56,150,624 M452K probably damaging Het
Phkg2 T C 7: 127,573,941 Y24H probably damaging Het
Pigr G A 1: 130,841,817 D122N probably benign Het
Prg4 C T 1: 150,460,681 C97Y probably damaging Het
Ptdss1 T C 13: 66,945,288 V64A probably benign Het
Ralgapa2 T C 2: 146,447,311 K324E probably damaging Het
Rfx5 G A 3: 94,955,815 V73I probably benign Het
Riiad1 T C 3: 94,472,863 T42A probably benign Het
Rims2 T C 15: 39,454,445 V640A possibly damaging Het
Rnpep G T 1: 135,263,032 S592Y possibly damaging Het
Scap T C 9: 110,378,390 L431P probably damaging Het
Siglec1 T A 2: 131,073,361 I1437F possibly damaging Het
Skint1 T C 4: 112,028,333 probably null Het
Slc44a1 A G 4: 53,543,644 E396G probably damaging Het
Slc4a2 T C 5: 24,434,869 F521S probably damaging Het
Smarcc1 T A 9: 110,175,061 S394R probably damaging Het
Socs1 A G 16: 10,784,685 S63P probably benign Het
Sun1 T G 5: 139,225,333 S20A possibly damaging Het
Tac4 A T 11: 95,265,242 K50* probably null Het
Tcaf2 A G 6: 42,642,640 I151T probably damaging Het
Tcf4 T C 18: 69,681,769 V587A probably damaging Het
Ttc37 T A 13: 76,182,936 M1495K probably damaging Het
Ttn T A 2: 76,740,909 K24801* probably null Het
Tuba3b G T 6: 145,621,273 M413I possibly damaging Het
Ufl1 C T 4: 25,267,832 A280T possibly damaging Het
Ugt2b5 T A 5: 87,139,673 I212L probably benign Het
Umodl1 A G 17: 30,986,485 T685A probably benign Het
Uqcrc1 T A 9: 108,944,810 V183D probably damaging Het
Ush2a A G 1: 188,910,720 N4093S probably benign Het
Vmn1r167 C T 7: 23,505,228 S121N probably damaging Het
Vmn1r47 A G 6: 90,022,758 S291G possibly damaging Het
Vmn2r108 A G 17: 20,481,187 V17A probably benign Het
Vmn2r58 T A 7: 41,837,752 H573L probably benign Het
Xirp1 C T 9: 120,018,792 V342I probably damaging Het
Zfp462 A G 4: 55,051,204 M2226V possibly damaging Het
Zfp467 G A 6: 48,439,029 H230Y probably damaging Het
Zfp595 T A 13: 67,316,401 K599N probably damaging Het
Zfp819 C A 7: 43,617,296 T401K probably benign Het
Other mutations in Fat2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00720:Fat2 APN 11 55311244 missense probably benign
IGL00897:Fat2 APN 11 55289252 missense probably damaging 0.99
IGL01161:Fat2 APN 11 55284191 missense probably benign
IGL01306:Fat2 APN 11 55310872 missense probably benign 0.28
IGL01393:Fat2 APN 11 55269309 missense probably benign 0.00
IGL01529:Fat2 APN 11 55282156 missense probably damaging 1.00
IGL01530:Fat2 APN 11 55283387 missense probably benign 0.42
IGL01555:Fat2 APN 11 55278930 missense probably damaging 0.99
IGL01758:Fat2 APN 11 55296209 missense probably damaging 1.00
IGL01768:Fat2 APN 11 55262568 missense probably damaging 1.00
IGL01939:Fat2 APN 11 55283980 missense probably benign 0.01
IGL01941:Fat2 APN 11 55312005 missense probably benign 0.01
IGL01967:Fat2 APN 11 55311823 missense probably damaging 1.00
IGL01978:Fat2 APN 11 55270146 missense probably benign 0.34
IGL01998:Fat2 APN 11 55296195 missense probably benign 0.00
IGL02001:Fat2 APN 11 55312245 start codon destroyed probably null 0.89
IGL02004:Fat2 APN 11 55282840 missense probably damaging 1.00
IGL02103:Fat2 APN 11 55289296 missense probably damaging 0.96
IGL02131:Fat2 APN 11 55309042 missense probably damaging 1.00
IGL02155:Fat2 APN 11 55262419 missense probably benign 0.00
IGL02223:Fat2 APN 11 55273129 missense probably benign 0.01
IGL02231:Fat2 APN 11 55281092 missense probably damaging 0.98
IGL02312:Fat2 APN 11 55270259 missense probably damaging 1.00
IGL02476:Fat2 APN 11 55311124 missense probably damaging 1.00
IGL02539:Fat2 APN 11 55281793 missense probably damaging 1.00
IGL02553:Fat2 APN 11 55311283 missense probably damaging 1.00
IGL02645:Fat2 APN 11 55282828 missense probably damaging 1.00
IGL02664:Fat2 APN 11 55311096 missense probably damaging 1.00
IGL02708:Fat2 APN 11 55282385 missense probably damaging 0.99
IGL02883:Fat2 APN 11 55256618 missense probably benign 0.16
IGL02894:Fat2 APN 11 55256653 missense probably damaging 1.00
IGL02975:Fat2 APN 11 55270194 missense probably benign 0.00
IGL03085:Fat2 APN 11 55283246 missense probably benign 0.09
IGL03106:Fat2 APN 11 55311901 missense probably benign 0.45
IGL03132:Fat2 APN 11 55253920 missense probably benign 0.25
IGL03133:Fat2 APN 11 55286043 missense probably benign 0.01
IGL03194:Fat2 APN 11 55310995 missense probably benign 0.02
IGL03266:Fat2 APN 11 55284029 missense possibly damaging 0.62
IGL03290:Fat2 APN 11 55256219 missense probably benign 0.33
IGL03291:Fat2 APN 11 55262595 missense probably benign
IGL03325:Fat2 APN 11 55282342 missense probably damaging 1.00
IGL03345:Fat2 APN 11 55282361 missense probably damaging 1.00
IGL03371:Fat2 APN 11 55311164 missense probably benign 0.10
ANU23:Fat2 UTSW 11 55310872 missense probably benign 0.28
P0040:Fat2 UTSW 11 55282213 missense possibly damaging 0.89
PIT4504001:Fat2 UTSW 11 55256110 missense possibly damaging 0.68
R0008:Fat2 UTSW 11 55311249 missense probably damaging 1.00
R0008:Fat2 UTSW 11 55311249 missense probably damaging 1.00
R0012:Fat2 UTSW 11 55262871 missense probably benign 0.16
R0012:Fat2 UTSW 11 55262871 missense probably benign 0.16
R0048:Fat2 UTSW 11 55310039 missense probably benign 0.00
R0048:Fat2 UTSW 11 55310039 missense probably benign 0.00
R0098:Fat2 UTSW 11 55298605 missense probably damaging 0.98
R0124:Fat2 UTSW 11 55283678 missense probably damaging 0.98
R0127:Fat2 UTSW 11 55289286 missense probably benign 0.01
R0130:Fat2 UTSW 11 55252118 missense probably benign 0.26
R0131:Fat2 UTSW 11 55273211 missense probably benign
R0158:Fat2 UTSW 11 55296185 missense probably benign 0.00
R0184:Fat2 UTSW 11 55296288 missense probably damaging 1.00
R0367:Fat2 UTSW 11 55292093 splice site probably benign
R0384:Fat2 UTSW 11 55269465 missense possibly damaging 0.81
R0390:Fat2 UTSW 11 55310777 missense probably damaging 0.99
R0403:Fat2 UTSW 11 55270349 missense probably benign 0.42
R0416:Fat2 UTSW 11 55284134 missense possibly damaging 0.94
R0437:Fat2 UTSW 11 55282799 missense probably benign 0.02
R0463:Fat2 UTSW 11 55262829 missense probably damaging 1.00
R0497:Fat2 UTSW 11 55283402 missense probably benign 0.03
R0617:Fat2 UTSW 11 55311843 missense possibly damaging 0.60
R0622:Fat2 UTSW 11 55283128 missense probably damaging 1.00
R0675:Fat2 UTSW 11 55309209 missense probably damaging 0.97
R0811:Fat2 UTSW 11 55253633 missense possibly damaging 0.75
R0812:Fat2 UTSW 11 55253633 missense possibly damaging 0.75
R0869:Fat2 UTSW 11 55311775 missense probably benign 0.08
R0870:Fat2 UTSW 11 55311775 missense probably benign 0.08
R0899:Fat2 UTSW 11 55256225 missense probably damaging 1.00
R1278:Fat2 UTSW 11 55268179 missense probably damaging 1.00
R1383:Fat2 UTSW 11 55310773 missense probably benign
R1428:Fat2 UTSW 11 55296087 missense probably damaging 1.00
R1438:Fat2 UTSW 11 55287811 missense probably damaging 1.00
R1495:Fat2 UTSW 11 55262673 missense probably benign
R1506:Fat2 UTSW 11 55284264 missense probably benign
R1547:Fat2 UTSW 11 55252255 missense probably benign 0.01
R1554:Fat2 UTSW 11 55253664 missense probably benign 0.01
R1562:Fat2 UTSW 11 55309974 missense probably damaging 1.00
R1588:Fat2 UTSW 11 55283404 missense probably damaging 1.00
R1592:Fat2 UTSW 11 55291870 splice site probably null
R1601:Fat2 UTSW 11 55282010 missense probably benign 0.01
R1610:Fat2 UTSW 11 55278924 missense probably damaging 1.00
R1634:Fat2 UTSW 11 55267684 missense probably damaging 1.00
R1634:Fat2 UTSW 11 55284719 missense probably benign
R1644:Fat2 UTSW 11 55287783 missense possibly damaging 0.91
R1644:Fat2 UTSW 11 55296181 missense possibly damaging 0.94
R1691:Fat2 UTSW 11 55311852 missense probably damaging 0.99
R1734:Fat2 UTSW 11 55281371 missense probably benign 0.00
R1748:Fat2 UTSW 11 55256647 missense probably damaging 0.97
R1771:Fat2 UTSW 11 55310865 missense probably benign 0.01
R1800:Fat2 UTSW 11 55283892 missense probably damaging 1.00
R1807:Fat2 UTSW 11 55289259 missense probably damaging 1.00
R1823:Fat2 UTSW 11 55256780 missense probably benign 0.29
R1848:Fat2 UTSW 11 55311558 missense probably damaging 1.00
R1866:Fat2 UTSW 11 55292014 missense probably benign 0.00
R1899:Fat2 UTSW 11 55262178 missense probably benign
R1954:Fat2 UTSW 11 55311084 missense probably benign 0.06
R2010:Fat2 UTSW 11 55253827 missense probably damaging 0.99
R2011:Fat2 UTSW 11 55282757 missense probably damaging 1.00
R2057:Fat2 UTSW 11 55281860 missense possibly damaging 0.60
R2081:Fat2 UTSW 11 55309677 missense possibly damaging 0.94
R2106:Fat2 UTSW 11 55256564 missense probably benign 0.00
R2165:Fat2 UTSW 11 55303716 missense probably benign 0.00
R2176:Fat2 UTSW 11 55267575 critical splice donor site probably null
R2284:Fat2 UTSW 11 55282360 missense probably damaging 1.00
R2338:Fat2 UTSW 11 55311901 missense possibly damaging 0.93
R2340:Fat2 UTSW 11 55270096 missense possibly damaging 0.90
R2427:Fat2 UTSW 11 55310812 missense probably benign 0.15
R2444:Fat2 UTSW 11 55281973 missense probably damaging 1.00
R2858:Fat2 UTSW 11 55283773 missense possibly damaging 0.94
R2882:Fat2 UTSW 11 55311305 missense probably damaging 0.96
R3029:Fat2 UTSW 11 55284709 missense probably damaging 1.00
R3085:Fat2 UTSW 11 55252171 missense possibly damaging 0.79
R3121:Fat2 UTSW 11 55311796 missense probably damaging 1.00
R3418:Fat2 UTSW 11 55278998 missense probably benign 0.01
R3500:Fat2 UTSW 11 55260516 missense probably damaging 0.99
R3607:Fat2 UTSW 11 55281685 missense probably damaging 1.00
R3611:Fat2 UTSW 11 55312069 missense probably benign
R3620:Fat2 UTSW 11 55256695 missense probably damaging 0.97
R3688:Fat2 UTSW 11 55281101 missense probably damaging 0.99
R3704:Fat2 UTSW 11 55309650 missense probably damaging 1.00
R3784:Fat2 UTSW 11 55256186 missense probably benign
R3889:Fat2 UTSW 11 55281763 missense probably damaging 1.00
R3951:Fat2 UTSW 11 55296382 missense probably benign 0.00
R4211:Fat2 UTSW 11 55283984 missense probably damaging 1.00
R4249:Fat2 UTSW 11 55284301 missense probably damaging 0.98
R4406:Fat2 UTSW 11 55262268 missense probably benign 0.00
R4433:Fat2 UTSW 11 55309640 missense possibly damaging 0.91
R4436:Fat2 UTSW 11 55296198 missense probably damaging 1.00
R4498:Fat2 UTSW 11 55270097 missense possibly damaging 0.90
R4560:Fat2 UTSW 11 55265951 missense possibly damaging 0.89
R4594:Fat2 UTSW 11 55284752 missense possibly damaging 0.78
R4663:Fat2 UTSW 11 55296213 nonsense probably null
R4669:Fat2 UTSW 11 55311615 missense probably benign 0.01
R4696:Fat2 UTSW 11 55285015 missense probably benign 0.00
R4734:Fat2 UTSW 11 55311468 missense probably benign 0.01
R4749:Fat2 UTSW 11 55311468 missense probably benign 0.01
R4765:Fat2 UTSW 11 55281187 missense probably damaging 1.00
R4803:Fat2 UTSW 11 55285060 missense probably benign 0.03
R4805:Fat2 UTSW 11 55283979 missense probably benign 0.01
R4822:Fat2 UTSW 11 55311318 missense probably benign 0.02
R4840:Fat2 UTSW 11 55279018 missense probably benign 0.21
R4849:Fat2 UTSW 11 55310637 missense probably damaging 1.00
R4943:Fat2 UTSW 11 55279033 missense probably benign 0.00
R5097:Fat2 UTSW 11 55310704 missense probably damaging 1.00
R5104:Fat2 UTSW 11 55278988 missense possibly damaging 0.93
R5115:Fat2 UTSW 11 55296333 missense probably damaging 1.00
R5213:Fat2 UTSW 11 55253832 missense probably benign 0.00
R5254:Fat2 UTSW 11 55281175 missense probably damaging 1.00
R5269:Fat2 UTSW 11 55287878 missense probably benign 0.00
R5288:Fat2 UTSW 11 55267656 missense probably benign 0.00
R5355:Fat2 UTSW 11 55282166 missense probably damaging 1.00
R5375:Fat2 UTSW 11 55262820 missense probably benign 0.00
R5379:Fat2 UTSW 11 55303941 missense probably damaging 0.99
R5411:Fat2 UTSW 11 55252226 missense probably benign 0.23
R5416:Fat2 UTSW 11 55303688 missense possibly damaging 0.77
R5480:Fat2 UTSW 11 55310086 missense probably damaging 0.99
R5486:Fat2 UTSW 11 55253681 missense probably benign 0.00
R5526:Fat2 UTSW 11 55269361 missense possibly damaging 0.90
R5532:Fat2 UTSW 11 55262337 missense probably damaging 1.00
R5583:Fat2 UTSW 11 55253889 missense probably benign 0.00
R5588:Fat2 UTSW 11 55282277 missense probably damaging 1.00
R5598:Fat2 UTSW 11 55281130 missense probably damaging 1.00
R5636:Fat2 UTSW 11 55282481 missense probably damaging 1.00
R5653:Fat2 UTSW 11 55310316 missense probably damaging 1.00
R5657:Fat2 UTSW 11 55310681 nonsense probably null
R5660:Fat2 UTSW 11 55284176 missense probably benign 0.00
R5752:Fat2 UTSW 11 55289237 missense possibly damaging 0.48
R5757:Fat2 UTSW 11 55252346 missense probably damaging 1.00
R5792:Fat2 UTSW 11 55262325 missense possibly damaging 0.77
R5872:Fat2 UTSW 11 55270382 missense probably damaging 1.00
R5933:Fat2 UTSW 11 55284051 missense probably damaging 1.00
R6030:Fat2 UTSW 11 55310303 nonsense probably null
R6030:Fat2 UTSW 11 55310303 nonsense probably null
R6032:Fat2 UTSW 11 55253934 missense probably damaging 1.00
R6032:Fat2 UTSW 11 55253934 missense probably damaging 1.00
R6221:Fat2 UTSW 11 55296072 critical splice donor site probably null
R6253:Fat2 UTSW 11 55296271 missense probably damaging 1.00
R6257:Fat2 UTSW 11 55262581 missense probably benign
R6307:Fat2 UTSW 11 55281280 missense possibly damaging 0.63
R6450:Fat2 UTSW 11 55289310 missense probably damaging 0.97
R6453:Fat2 UTSW 11 55282216 missense probably benign 0.29
R6455:Fat2 UTSW 11 55270457 missense probably damaging 0.96
R6483:Fat2 UTSW 11 55296345 missense probably damaging 1.00
R6504:Fat2 UTSW 11 55262397 missense probably benign 0.00
R6520:Fat2 UTSW 11 55284988 missense probably damaging 0.99
R6525:Fat2 UTSW 11 55283800 missense probably damaging 1.00
R6617:Fat2 UTSW 11 55296105 missense probably benign 0.01
R6652:Fat2 UTSW 11 55252262 missense probably benign
R6679:Fat2 UTSW 11 55309305 missense probably damaging 1.00
R6680:Fat2 UTSW 11 55310858 nonsense probably null
R6762:Fat2 UTSW 11 55253482 intron probably null
R6810:Fat2 UTSW 11 55282241 missense possibly damaging 0.88
R6818:Fat2 UTSW 11 55309341 missense probably benign 0.31
R6919:Fat2 UTSW 11 55282771 missense possibly damaging 0.68
R6939:Fat2 UTSW 11 55252474 nonsense probably null
R6941:Fat2 UTSW 11 55262088 missense probably benign
R7023:Fat2 UTSW 11 55310502 missense probably benign 0.00
R7027:Fat2 UTSW 11 55269433 missense probably benign 0.03
R7027:Fat2 UTSW 11 55281851 nonsense probably null
R7095:Fat2 UTSW 11 55311331 missense probably damaging 1.00
R7102:Fat2 UTSW 11 55283434 missense probably damaging 1.00
R7116:Fat2 UTSW 11 55282336 missense probably damaging 1.00
R7117:Fat2 UTSW 11 55281262 missense probably damaging 1.00
R7167:Fat2 UTSW 11 55285001 missense possibly damaging 0.48
R7213:Fat2 UTSW 11 55281045 nonsense probably null
R7246:Fat2 UTSW 11 55296382 missense probably benign 0.00
R7252:Fat2 UTSW 11 55311262 missense probably damaging 0.98
R7266:Fat2 UTSW 11 55285030 missense probably damaging 0.99
R7316:Fat2 UTSW 11 55286067 missense probably damaging 1.00
X0010:Fat2 UTSW 11 55252260 missense probably benign 0.00
X0011:Fat2 UTSW 11 55310431 missense probably damaging 0.98
X0018:Fat2 UTSW 11 55296210 missense probably damaging 1.00
X0028:Fat2 UTSW 11 55309414 missense possibly damaging 0.84
X0067:Fat2 UTSW 11 55283234 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- AGCCTCATAGTCCAGCTCTTG -3'
(R):5'- GCCTGAGGCTCATCTATAACATTG -3'

Sequencing Primer
(F):5'- TCCATTGATCCGGAAGAACTTAG -3'
(R):5'- GAGGCTCATCTATAACATTGTAGAGG -3'
Posted On2016-05-10