Incidental Mutation 'R4993:Ncor1'
ID385035
Institutional Source Beutler Lab
Gene Symbol Ncor1
Ensembl Gene ENSMUSG00000018501
Gene Namenuclear receptor co-repressor 1
Synonyms5730405M06Rik, A230020K14Rik, Rxrip13, N-CoR
MMRRC Submission 042587-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4993 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location62316426-62458541 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 62343341 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Arginine at position 669 (I669R)
Ref Sequence ENSEMBL: ENSMUSP00000122654 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018645] [ENSMUST00000037575] [ENSMUST00000101066] [ENSMUST00000101067] [ENSMUST00000151498] [ENSMUST00000155712]
Predicted Effect probably damaging
Transcript: ENSMUST00000018645
AA Change: I1400R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000018645
Gene: ENSMUSG00000018501
AA Change: I1400R

DomainStartEndE-ValueType
low complexity region 51 74 N/A INTRINSIC
Pfam:GPS2_interact 150 239 1.4e-37 PFAM
coiled coil region 302 329 N/A INTRINSIC
low complexity region 349 366 N/A INTRINSIC
SANT 437 485 2.76e-7 SMART
coiled coil region 507 544 N/A INTRINSIC
low complexity region 593 617 N/A INTRINSIC
SANT 624 672 3.29e-14 SMART
low complexity region 710 731 N/A INTRINSIC
low complexity region 771 788 N/A INTRINSIC
low complexity region 888 899 N/A INTRINSIC
low complexity region 987 995 N/A INTRINSIC
low complexity region 1002 1013 N/A INTRINSIC
low complexity region 1036 1049 N/A INTRINSIC
internal_repeat_2 1061 1298 1.62e-6 PROSPERO
internal_repeat_2 1299 1515 1.62e-6 PROSPERO
low complexity region 1516 1527 N/A INTRINSIC
coiled coil region 1712 1749 N/A INTRINSIC
low complexity region 1834 1848 N/A INTRINSIC
low complexity region 1969 1980 N/A INTRINSIC
low complexity region 2036 2055 N/A INTRINSIC
PDB:3N00|B 2064 2084 4e-7 PDB
low complexity region 2086 2101 N/A INTRINSIC
low complexity region 2157 2168 N/A INTRINSIC
PDB:2OVM|B 2267 2290 2e-8 PDB
low complexity region 2311 2324 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000037575
AA Change: I345R

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000038900
Gene: ENSMUSG00000018501
AA Change: I345R

DomainStartEndE-ValueType
low complexity region 28 41 N/A INTRINSIC
low complexity region 461 472 N/A INTRINSIC
coiled coil region 658 695 N/A INTRINSIC
low complexity region 780 794 N/A INTRINSIC
low complexity region 915 926 N/A INTRINSIC
low complexity region 982 1001 N/A INTRINSIC
PDB:3N00|B 1010 1030 2e-7 PDB
low complexity region 1032 1047 N/A INTRINSIC
low complexity region 1102 1113 N/A INTRINSIC
PDB:2OVM|B 1212 1235 2e-8 PDB
low complexity region 1256 1269 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000101066
AA Change: I1400R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000098627
Gene: ENSMUSG00000018501
AA Change: I1400R

DomainStartEndE-ValueType
low complexity region 51 74 N/A INTRINSIC
coiled coil region 176 217 N/A INTRINSIC
coiled coil region 302 329 N/A INTRINSIC
low complexity region 349 366 N/A INTRINSIC
SANT 437 485 2.76e-7 SMART
coiled coil region 507 544 N/A INTRINSIC
low complexity region 593 617 N/A INTRINSIC
SANT 624 672 3.29e-14 SMART
low complexity region 710 731 N/A INTRINSIC
low complexity region 771 788 N/A INTRINSIC
low complexity region 888 899 N/A INTRINSIC
low complexity region 987 995 N/A INTRINSIC
low complexity region 1002 1013 N/A INTRINSIC
low complexity region 1036 1049 N/A INTRINSIC
internal_repeat_2 1061 1298 1.62e-6 PROSPERO
internal_repeat_2 1299 1515 1.62e-6 PROSPERO
low complexity region 1516 1527 N/A INTRINSIC
coiled coil region 1712 1749 N/A INTRINSIC
low complexity region 1834 1848 N/A INTRINSIC
low complexity region 1969 1980 N/A INTRINSIC
low complexity region 2036 2055 N/A INTRINSIC
PDB:3N00|B 2064 2084 4e-7 PDB
low complexity region 2086 2101 N/A INTRINSIC
low complexity region 2157 2168 N/A INTRINSIC
PDB:2OVM|B 2267 2290 2e-8 PDB
low complexity region 2311 2324 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000101067
AA Change: I1332R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000098628
Gene: ENSMUSG00000018501
AA Change: I1332R

DomainStartEndE-ValueType
low complexity region 51 74 N/A INTRINSIC
coiled coil region 176 217 N/A INTRINSIC
coiled coil region 302 329 N/A INTRINSIC
low complexity region 349 366 N/A INTRINSIC
SANT 437 485 2.76e-7 SMART
coiled coil region 507 544 N/A INTRINSIC
low complexity region 593 617 N/A INTRINSIC
SANT 624 672 3.29e-14 SMART
low complexity region 716 734 N/A INTRINSIC
low complexity region 838 849 N/A INTRINSIC
low complexity region 937 945 N/A INTRINSIC
low complexity region 952 963 N/A INTRINSIC
low complexity region 986 999 N/A INTRINSIC
low complexity region 1448 1459 N/A INTRINSIC
coiled coil region 1645 1682 N/A INTRINSIC
low complexity region 1767 1781 N/A INTRINSIC
low complexity region 1902 1913 N/A INTRINSIC
low complexity region 1969 1988 N/A INTRINSIC
PDB:3N00|B 1997 2017 4e-7 PDB
low complexity region 2019 2034 N/A INTRINSIC
low complexity region 2089 2100 N/A INTRINSIC
PDB:2OVM|B 2199 2222 2e-8 PDB
low complexity region 2243 2256 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151498
SMART Domains Protein: ENSMUSP00000125317
Gene: ENSMUSG00000018501

DomainStartEndE-ValueType
SANT 37 85 2.76e-7 SMART
coiled coil region 107 144 N/A INTRINSIC
low complexity region 193 217 N/A INTRINSIC
SANT 224 272 3.29e-14 SMART
low complexity region 316 337 N/A INTRINSIC
low complexity region 361 378 N/A INTRINSIC
low complexity region 478 489 N/A INTRINSIC
low complexity region 577 585 N/A INTRINSIC
low complexity region 592 603 N/A INTRINSIC
low complexity region 684 697 N/A INTRINSIC
internal_repeat_2 700 830 5.77e-7 PROSPERO
internal_repeat_2 855 961 5.77e-7 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000155712
AA Change: I669R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122654
Gene: ENSMUSG00000018501
AA Change: I669R

DomainStartEndE-ValueType
low complexity region 26 47 N/A INTRINSIC
low complexity region 87 104 N/A INTRINSIC
low complexity region 204 215 N/A INTRINSIC
low complexity region 303 311 N/A INTRINSIC
low complexity region 318 329 N/A INTRINSIC
low complexity region 352 365 N/A INTRINSIC
low complexity region 785 796 N/A INTRINSIC
coiled coil region 982 1019 N/A INTRINSIC
low complexity region 1104 1118 N/A INTRINSIC
low complexity region 1239 1250 N/A INTRINSIC
low complexity region 1306 1325 N/A INTRINSIC
PDB:3N00|B 1334 1354 3e-7 PDB
low complexity region 1356 1371 N/A INTRINSIC
low complexity region 1427 1438 N/A INTRINSIC
PDB:2OVM|B 1537 1560 2e-8 PDB
low complexity region 1581 1594 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000156740
AA Change: I334R
SMART Domains Protein: ENSMUSP00000125458
Gene: ENSMUSG00000018501
AA Change: I334R

DomainStartEndE-ValueType
low complexity region 18 31 N/A INTRINSIC
low complexity region 451 462 N/A INTRINSIC
coiled coil region 647 684 N/A INTRINSIC
low complexity region 770 784 N/A INTRINSIC
low complexity region 905 916 N/A INTRINSIC
low complexity region 972 991 N/A INTRINSIC
PDB:3N00|B 1000 1020 2e-7 PDB
low complexity region 1022 1037 N/A INTRINSIC
low complexity region 1092 1103 N/A INTRINSIC
PDB:2OVM|B 1202 1225 2e-8 PDB
low complexity region 1246 1259 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159224
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161432
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that mediates ligand-independent transcription repression of thyroid-hormone and retinoic-acid receptors by promoting chromatin condensation and preventing access of the transcription machinery. It is part of a complex which also includes histone deacetylases and transcriptional regulators similar to the yeast protein Sin3p. This gene is located between the Charcot-Marie-Tooth and Smith-Magenis syndrome critical regions on chromosome 17. Alternate splicing results in multiple transcript variants. Pseudogenes of this gene are found on chromosomes 17 and 20.[provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for a targeted mutation in this gene exhibit embryonic lethality with erythrocytic, thymocytic and central nervous system development abnormalities. Mice homozygous for a hypomorphic allele exhibit increased thyroid hormone sensitivity under hypothyroid conditions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
9130008F23Rik G T 17: 40,880,161 Q126K probably benign Het
Abca15 C A 7: 120,401,718 N1492K probably damaging Het
Afap1l2 C T 19: 56,918,040 D402N probably damaging Het
Akap11 A G 14: 78,512,968 F660L probably damaging Het
Bcl3 T C 7: 19,820,177 T89A probably benign Het
Bub1b T C 2: 118,636,770 I858T possibly damaging Het
Cdk19 A G 10: 40,476,218 D288G possibly damaging Het
Cyp2d34 T A 15: 82,618,329 D202V probably damaging Het
Dip2c T G 13: 9,575,223 Y584* probably null Het
Dpf3 A T 12: 83,331,861 probably null Het
Drp2 G A X: 134,441,316 R567H probably damaging Homo
Emid1 G T 11: 5,131,512 Q212K probably benign Het
Esm1 C T 13: 113,213,399 Q118* probably null Het
Fahd2a T G 2: 127,436,364 I308L probably benign Het
Fam208a T A 14: 27,429,114 W16R possibly damaging Het
Fanci T C 7: 79,435,378 *851Q probably null Het
Fastkd1 C A 2: 69,702,740 V428F probably damaging Het
Fat2 A T 11: 55,283,092 I2265N probably damaging Het
Gale C A 4: 135,966,860 H191Q probably damaging Het
Ghsr T A 3: 27,372,254 V153E possibly damaging Het
Gm10696 C T 3: 94,176,316 G63R probably damaging Het
Gpc6 A G 14: 117,624,539 N289S possibly damaging Het
Hoxb6 A T 11: 96,300,711 Y153F probably damaging Het
Ints3 T C 3: 90,415,507 T139A probably benign Het
Irf2bp2 A G 8: 126,592,671 S256P probably benign Het
Klf4 G T 4: 55,530,640 P148Q probably damaging Het
Loxl1 T G 9: 58,312,537 H117P probably damaging Het
Lpl A G 8: 68,895,793 K225E probably benign Het
Lrba T A 3: 86,360,037 V1678D probably damaging Het
Med1 A T 11: 98,163,904 F398Y probably damaging Het
Mfap2 T C 4: 141,015,578 *186Q probably null Het
Mfsd3 T C 15: 76,701,982 L105P probably damaging Het
Mlxip T G 5: 123,395,294 I122S probably damaging Het
Mmrn2 A T 14: 34,396,398 Y107F probably damaging Het
Mtg1 G T 7: 140,140,283 D88Y probably null Het
Mutyh T A 4: 116,817,935 S426R probably benign Het
Myo16 C T 8: 10,476,094 T878I probably damaging Het
Myo9a T A 9: 59,861,472 Y912* probably null Het
Ndufs1 T C 1: 63,163,776 I210V probably benign Het
Nek9 A G 12: 85,310,420 C657R probably damaging Het
Noct C T 3: 51,250,021 T260I probably damaging Het
Nr1h4 A T 10: 89,498,180 M102K probably benign Het
Obscn G A 11: 59,124,761 R1054C possibly damaging Het
Olfr1124 T A 2: 87,435,152 F222I probably benign Het
Olfr352 C A 2: 36,869,988 Q141K probably benign Het
Olfr47 A G 6: 43,236,456 M283V possibly damaging Het
Olfr501-ps1 G A 7: 108,508,243 M62I probably damaging Het
Olfr615 T A 7: 103,561,317 I280N possibly damaging Het
Olfr619 A T 7: 103,603,656 M1L probably benign Het
Otol1 C A 3: 70,018,878 Q129K probably benign Het
Otx1 A T 11: 21,998,532 probably null Het
Pcdhac2 C A 18: 37,146,251 N761K probably damaging Het
Pde1c A T 6: 56,150,624 M452K probably damaging Het
Phkg2 T C 7: 127,573,941 Y24H probably damaging Het
Pigr G A 1: 130,841,817 D122N probably benign Het
Prg4 C T 1: 150,460,681 C97Y probably damaging Het
Ptdss1 T C 13: 66,945,288 V64A probably benign Het
Ralgapa2 T C 2: 146,447,311 K324E probably damaging Het
Rfx5 G A 3: 94,955,815 V73I probably benign Het
Riiad1 T C 3: 94,472,863 T42A probably benign Het
Rims2 T C 15: 39,454,445 V640A possibly damaging Het
Rnpep G T 1: 135,263,032 S592Y possibly damaging Het
Scap T C 9: 110,378,390 L431P probably damaging Het
Siglec1 T A 2: 131,073,361 I1437F possibly damaging Het
Skint1 T C 4: 112,028,333 probably null Het
Slc44a1 A G 4: 53,543,644 E396G probably damaging Het
Slc4a2 T C 5: 24,434,869 F521S probably damaging Het
Smarcc1 T A 9: 110,175,061 S394R probably damaging Het
Socs1 A G 16: 10,784,685 S63P probably benign Het
Sun1 T G 5: 139,225,333 S20A possibly damaging Het
Tac4 A T 11: 95,265,242 K50* probably null Het
Tcaf2 A G 6: 42,642,640 I151T probably damaging Het
Tcf4 T C 18: 69,681,769 V587A probably damaging Het
Ttc37 T A 13: 76,182,936 M1495K probably damaging Het
Ttn T A 2: 76,740,909 K24801* probably null Het
Tuba3b G T 6: 145,621,273 M413I possibly damaging Het
Ufl1 C T 4: 25,267,832 A280T possibly damaging Het
Ugt2b5 T A 5: 87,139,673 I212L probably benign Het
Umodl1 A G 17: 30,986,485 T685A probably benign Het
Uqcrc1 T A 9: 108,944,810 V183D probably damaging Het
Ush2a A G 1: 188,910,720 N4093S probably benign Het
Vmn1r167 C T 7: 23,505,228 S121N probably damaging Het
Vmn1r47 A G 6: 90,022,758 S291G possibly damaging Het
Vmn2r108 A G 17: 20,481,187 V17A probably benign Het
Vmn2r58 T A 7: 41,837,752 H573L probably benign Het
Xirp1 C T 9: 120,018,792 V342I probably damaging Het
Zfp462 A G 4: 55,051,204 M2226V possibly damaging Het
Zfp467 G A 6: 48,439,029 H230Y probably damaging Het
Zfp595 T A 13: 67,316,401 K599N probably damaging Het
Zfp819 C A 7: 43,617,296 T401K probably benign Het
Other mutations in Ncor1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01067:Ncor1 APN 11 62392528 missense probably damaging 1.00
IGL01343:Ncor1 APN 11 62325486 critical splice donor site probably null
IGL01392:Ncor1 APN 11 62340594 missense probably damaging 0.99
IGL01402:Ncor1 APN 11 62340474 missense probably damaging 1.00
IGL01714:Ncor1 APN 11 62334584 missense possibly damaging 0.58
IGL01772:Ncor1 APN 11 62349347 intron probably benign
IGL01889:Ncor1 APN 11 62334601 missense possibly damaging 0.69
IGL02058:Ncor1 APN 11 62344637 missense probably damaging 1.00
IGL02065:Ncor1 APN 11 62419609 missense possibly damaging 0.95
IGL02073:Ncor1 APN 11 62358917 missense probably damaging 0.99
IGL02176:Ncor1 APN 11 62329659 unclassified probably benign
IGL02288:Ncor1 APN 11 62349403 missense probably benign 0.01
IGL02348:Ncor1 APN 11 62333659 splice site probably benign
IGL02608:Ncor1 APN 11 62373214 missense probably benign 0.07
LCD18:Ncor1 UTSW 11 62419782 critical splice acceptor site probably benign
R0026:Ncor1 UTSW 11 62438429 missense probably damaging 1.00
R0038:Ncor1 UTSW 11 62392551 missense probably damaging 0.99
R0038:Ncor1 UTSW 11 62392551 missense probably damaging 0.99
R0103:Ncor1 UTSW 11 62343045 missense possibly damaging 0.85
R0103:Ncor1 UTSW 11 62343045 missense possibly damaging 0.85
R0144:Ncor1 UTSW 11 62392595 missense probably damaging 1.00
R0427:Ncor1 UTSW 11 62410920 missense probably damaging 1.00
R0501:Ncor1 UTSW 11 62373322 missense possibly damaging 0.73
R0544:Ncor1 UTSW 11 62333776 missense probably damaging 1.00
R0544:Ncor1 UTSW 11 62333777 missense probably damaging 1.00
R0563:Ncor1 UTSW 11 62343230 missense probably damaging 0.97
R1074:Ncor1 UTSW 11 62392551 missense probably damaging 0.99
R1266:Ncor1 UTSW 11 62334040 missense probably damaging 0.98
R1444:Ncor1 UTSW 11 62403806 missense probably damaging 1.00
R1452:Ncor1 UTSW 11 62334631 missense probably damaging 1.00
R1534:Ncor1 UTSW 11 62378504 missense possibly damaging 0.92
R1710:Ncor1 UTSW 11 62423005 missense probably damaging 1.00
R1762:Ncor1 UTSW 11 62384784 missense possibly damaging 0.82
R1771:Ncor1 UTSW 11 62327112 missense probably damaging 1.00
R1864:Ncor1 UTSW 11 62381419 missense probably damaging 1.00
R1902:Ncor1 UTSW 11 62338158 missense probably damaging 1.00
R1906:Ncor1 UTSW 11 62349385 missense possibly damaging 0.81
R2009:Ncor1 UTSW 11 62325601 missense probably benign 0.43
R3708:Ncor1 UTSW 11 62344687 missense probably damaging 1.00
R3825:Ncor1 UTSW 11 62373357 missense probably benign 0.00
R3923:Ncor1 UTSW 11 62325616 missense probably damaging 1.00
R3966:Ncor1 UTSW 11 62344757 missense probably damaging 1.00
R4049:Ncor1 UTSW 11 62329668 intron probably null
R4350:Ncor1 UTSW 11 62410818 critical splice donor site probably null
R4351:Ncor1 UTSW 11 62410818 critical splice donor site probably null
R4359:Ncor1 UTSW 11 62358910 missense probably damaging 1.00
R4712:Ncor1 UTSW 11 62344834 missense probably damaging 1.00
R4723:Ncor1 UTSW 11 62378612 missense probably benign 0.26
R4863:Ncor1 UTSW 11 62392638 missense possibly damaging 0.92
R4875:Ncor1 UTSW 11 62433611 small deletion probably benign
R4956:Ncor1 UTSW 11 62340605 missense probably damaging 1.00
R5079:Ncor1 UTSW 11 62345237 missense possibly damaging 0.92
R5144:Ncor1 UTSW 11 62349464 missense probably damaging 1.00
R5223:Ncor1 UTSW 11 62339000 missense probably damaging 1.00
R5243:Ncor1 UTSW 11 62338962 missense probably damaging 1.00
R5271:Ncor1 UTSW 11 62340545 missense probably damaging 1.00
R5285:Ncor1 UTSW 11 62392649 missense probably damaging 1.00
R5533:Ncor1 UTSW 11 62343011 missense probably benign 0.00
R5580:Ncor1 UTSW 11 62389778 nonsense probably null
R5593:Ncor1 UTSW 11 62369304 missense probably damaging 1.00
R5609:Ncor1 UTSW 11 62358853 unclassified probably null
R5632:Ncor1 UTSW 11 62338234 missense possibly damaging 0.85
R5830:Ncor1 UTSW 11 62344763 missense possibly damaging 0.71
R5896:Ncor1 UTSW 11 62383190 missense probably damaging 1.00
R5973:Ncor1 UTSW 11 62349310 intron probably null
R6013:Ncor1 UTSW 11 62321077 missense probably benign
R6019:Ncor1 UTSW 11 62373161 missense probably benign 0.00
R6032:Ncor1 UTSW 11 62373321 missense possibly damaging 0.54
R6032:Ncor1 UTSW 11 62373321 missense possibly damaging 0.54
R6075:Ncor1 UTSW 11 62317849 missense probably damaging 1.00
R6091:Ncor1 UTSW 11 62419617 missense probably damaging 0.98
R6248:Ncor1 UTSW 11 62366982 missense probably damaging 1.00
R6281:Ncor1 UTSW 11 62373545 missense possibly damaging 0.71
R6351:Ncor1 UTSW 11 62373298 missense probably benign 0.30
R6469:Ncor1 UTSW 11 62343302 missense probably damaging 1.00
R6502:Ncor1 UTSW 11 62381414 nonsense probably null
R6614:Ncor1 UTSW 11 62330819 missense probably benign 0.01
R6650:Ncor1 UTSW 11 62334541 missense probably damaging 1.00
R6765:Ncor1 UTSW 11 62373446 missense probably benign 0.01
R6852:Ncor1 UTSW 11 62343245 missense probably damaging 0.97
R6909:Ncor1 UTSW 11 62329486 missense probably damaging 1.00
R6965:Ncor1 UTSW 11 62353233 critical splice donor site probably null
R7054:Ncor1 UTSW 11 62384793 missense probably null
X0065:Ncor1 UTSW 11 62354569 critical splice donor site probably null
X0065:Ncor1 UTSW 11 62358991 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- CTTCGTGAAGTGTAGACCTGAG -3'
(R):5'- CACAGTTTGAGGTGACTAATTTGGG -3'

Sequencing Primer
(F):5'- AGAGCTCACCACTGACGTGTG -3'
(R):5'- AGGTGACTAATTTGGGAGTGTG -3'
Posted On2016-05-10