Incidental Mutation 'R4993:Dpf3'
ID385039
Institutional Source Beutler Lab
Gene Symbol Dpf3
Ensembl Gene ENSMUSG00000021221
Gene NameD4, zinc and double PHD fingers, family 3
Synonymscer-d4, 2810403B03Rik, CERD4
MMRRC Submission 042587-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.258) question?
Stock #R4993 (G1)
Quality Score167
Status Not validated
Chromosome12
Chromosomal Location83213745-83487716 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 83331861 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000136280 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000177801] [ENSMUST00000177959] [ENSMUST00000178756]
Predicted Effect probably null
Transcript: ENSMUST00000133282
SMART Domains Protein: ENSMUSP00000121199
Gene: ENSMUSG00000021221

DomainStartEndE-ValueType
low complexity region 80 100 N/A INTRINSIC
low complexity region 106 124 N/A INTRINSIC
ZnF_C2H2 133 156 1.82e-3 SMART
PDB:2KWO|A 195 227 2e-14 PDB
Blast:PHD 196 227 5e-14 BLAST
low complexity region 230 246 N/A INTRINSIC
low complexity region 272 283 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000144237
SMART Domains Protein: ENSMUSP00000122004
Gene: ENSMUSG00000021221

DomainStartEndE-ValueType
low complexity region 81 101 N/A INTRINSIC
low complexity region 107 125 N/A INTRINSIC
ZnF_C2H2 134 157 1.82e-3 SMART
PDB:2KWO|A 196 228 2e-14 PDB
Blast:PHD 197 228 5e-14 BLAST
low complexity region 231 247 N/A INTRINSIC
low complexity region 273 284 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000147469
SMART Domains Protein: ENSMUSP00000122598
Gene: ENSMUSG00000021221

DomainStartEndE-ValueType
low complexity region 81 101 N/A INTRINSIC
low complexity region 107 125 N/A INTRINSIC
ZnF_C2H2 134 157 1.82e-3 SMART
PHD 197 253 3.27e-9 SMART
RING 198 252 3.44e0 SMART
PHD 254 300 1.53e-9 SMART
RING 255 299 1.38e0 SMART
Predicted Effect probably null
Transcript: ENSMUST00000177801
SMART Domains Protein: ENSMUSP00000136740
Gene: ENSMUSG00000021221

DomainStartEndE-ValueType
Pfam:Requiem_N 8 43 2.9e-13 PFAM
low complexity region 103 123 N/A INTRINSIC
low complexity region 129 147 N/A INTRINSIC
ZnF_C2H2 156 179 1.82e-3 SMART
PDB:2KWO|A 218 250 4e-14 PDB
Blast:PHD 219 250 9e-14 BLAST
low complexity region 253 269 N/A INTRINSIC
low complexity region 295 306 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000177959
SMART Domains Protein: ENSMUSP00000137477
Gene: ENSMUSG00000021221

DomainStartEndE-ValueType
Pfam:Requiem_N 12 85 2.6e-40 PFAM
low complexity region 144 164 N/A INTRINSIC
low complexity region 170 188 N/A INTRINSIC
ZnF_C2H2 197 220 1.82e-3 SMART
PDB:2KWO|A 259 291 4e-14 PDB
Blast:PHD 260 291 1e-13 BLAST
low complexity region 294 310 N/A INTRINSIC
low complexity region 336 347 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000178756
SMART Domains Protein: ENSMUSP00000136280
Gene: ENSMUSG00000021221

DomainStartEndE-ValueType
Pfam:Requiem_N 13 84 4.8e-40 PFAM
low complexity region 145 165 N/A INTRINSIC
low complexity region 171 189 N/A INTRINSIC
ZnF_C2H2 198 221 1.82e-3 SMART
PHD 261 317 3.27e-9 SMART
RING 262 316 3.44e0 SMART
PHD 318 364 1.53e-9 SMART
RING 319 363 1.38e0 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the D4 protein family. The encoded protein is a transcription regulator that binds acetylated histones and is a component of the BAF chromatin remodeling complex. Alternate splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a null allele display no detectable phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
9130008F23Rik G T 17: 40,880,161 Q126K probably benign Het
Abca15 C A 7: 120,401,718 N1492K probably damaging Het
Afap1l2 C T 19: 56,918,040 D402N probably damaging Het
Akap11 A G 14: 78,512,968 F660L probably damaging Het
Bcl3 T C 7: 19,820,177 T89A probably benign Het
Bub1b T C 2: 118,636,770 I858T possibly damaging Het
Cdk19 A G 10: 40,476,218 D288G possibly damaging Het
Cyp2d34 T A 15: 82,618,329 D202V probably damaging Het
Dip2c T G 13: 9,575,223 Y584* probably null Het
Drp2 G A X: 134,441,316 R567H probably damaging Homo
Emid1 G T 11: 5,131,512 Q212K probably benign Het
Esm1 C T 13: 113,213,399 Q118* probably null Het
Fahd2a T G 2: 127,436,364 I308L probably benign Het
Fam208a T A 14: 27,429,114 W16R possibly damaging Het
Fanci T C 7: 79,435,378 *851Q probably null Het
Fastkd1 C A 2: 69,702,740 V428F probably damaging Het
Fat2 A T 11: 55,283,092 I2265N probably damaging Het
Gale C A 4: 135,966,860 H191Q probably damaging Het
Ghsr T A 3: 27,372,254 V153E possibly damaging Het
Gm10696 C T 3: 94,176,316 G63R probably damaging Het
Gpc6 A G 14: 117,624,539 N289S possibly damaging Het
Hoxb6 A T 11: 96,300,711 Y153F probably damaging Het
Ints3 T C 3: 90,415,507 T139A probably benign Het
Irf2bp2 A G 8: 126,592,671 S256P probably benign Het
Klf4 G T 4: 55,530,640 P148Q probably damaging Het
Loxl1 T G 9: 58,312,537 H117P probably damaging Het
Lpl A G 8: 68,895,793 K225E probably benign Het
Lrba T A 3: 86,360,037 V1678D probably damaging Het
Med1 A T 11: 98,163,904 F398Y probably damaging Het
Mfap2 T C 4: 141,015,578 *186Q probably null Het
Mfsd3 T C 15: 76,701,982 L105P probably damaging Het
Mlxip T G 5: 123,395,294 I122S probably damaging Het
Mmrn2 A T 14: 34,396,398 Y107F probably damaging Het
Mtg1 G T 7: 140,140,283 D88Y probably null Het
Mutyh T A 4: 116,817,935 S426R probably benign Het
Myo16 C T 8: 10,476,094 T878I probably damaging Het
Myo9a T A 9: 59,861,472 Y912* probably null Het
Ncor1 A C 11: 62,343,341 I669R probably damaging Het
Ndufs1 T C 1: 63,163,776 I210V probably benign Het
Nek9 A G 12: 85,310,420 C657R probably damaging Het
Noct C T 3: 51,250,021 T260I probably damaging Het
Nr1h4 A T 10: 89,498,180 M102K probably benign Het
Obscn G A 11: 59,124,761 R1054C possibly damaging Het
Olfr1124 T A 2: 87,435,152 F222I probably benign Het
Olfr352 C A 2: 36,869,988 Q141K probably benign Het
Olfr47 A G 6: 43,236,456 M283V possibly damaging Het
Olfr501-ps1 G A 7: 108,508,243 M62I probably damaging Het
Olfr615 T A 7: 103,561,317 I280N possibly damaging Het
Olfr619 A T 7: 103,603,656 M1L probably benign Het
Otol1 C A 3: 70,018,878 Q129K probably benign Het
Otx1 A T 11: 21,998,532 probably null Het
Pcdhac2 C A 18: 37,146,251 N761K probably damaging Het
Pde1c A T 6: 56,150,624 M452K probably damaging Het
Phkg2 T C 7: 127,573,941 Y24H probably damaging Het
Pigr G A 1: 130,841,817 D122N probably benign Het
Prg4 C T 1: 150,460,681 C97Y probably damaging Het
Ptdss1 T C 13: 66,945,288 V64A probably benign Het
Ralgapa2 T C 2: 146,447,311 K324E probably damaging Het
Rfx5 G A 3: 94,955,815 V73I probably benign Het
Riiad1 T C 3: 94,472,863 T42A probably benign Het
Rims2 T C 15: 39,454,445 V640A possibly damaging Het
Rnpep G T 1: 135,263,032 S592Y possibly damaging Het
Scap T C 9: 110,378,390 L431P probably damaging Het
Siglec1 T A 2: 131,073,361 I1437F possibly damaging Het
Skint1 T C 4: 112,028,333 probably null Het
Slc44a1 A G 4: 53,543,644 E396G probably damaging Het
Slc4a2 T C 5: 24,434,869 F521S probably damaging Het
Smarcc1 T A 9: 110,175,061 S394R probably damaging Het
Socs1 A G 16: 10,784,685 S63P probably benign Het
Sun1 T G 5: 139,225,333 S20A possibly damaging Het
Tac4 A T 11: 95,265,242 K50* probably null Het
Tcaf2 A G 6: 42,642,640 I151T probably damaging Het
Tcf4 T C 18: 69,681,769 V587A probably damaging Het
Ttc37 T A 13: 76,182,936 M1495K probably damaging Het
Ttn T A 2: 76,740,909 K24801* probably null Het
Tuba3b G T 6: 145,621,273 M413I possibly damaging Het
Ufl1 C T 4: 25,267,832 A280T possibly damaging Het
Ugt2b5 T A 5: 87,139,673 I212L probably benign Het
Umodl1 A G 17: 30,986,485 T685A probably benign Het
Uqcrc1 T A 9: 108,944,810 V183D probably damaging Het
Ush2a A G 1: 188,910,720 N4093S probably benign Het
Vmn1r167 C T 7: 23,505,228 S121N probably damaging Het
Vmn1r47 A G 6: 90,022,758 S291G possibly damaging Het
Vmn2r108 A G 17: 20,481,187 V17A probably benign Het
Vmn2r58 T A 7: 41,837,752 H573L probably benign Het
Xirp1 C T 9: 120,018,792 V342I probably damaging Het
Zfp462 A G 4: 55,051,204 M2226V possibly damaging Het
Zfp467 G A 6: 48,439,029 H230Y probably damaging Het
Zfp595 T A 13: 67,316,401 K599N probably damaging Het
Zfp819 C A 7: 43,617,296 T401K probably benign Het
Other mutations in Dpf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01452:Dpf3 APN 12 83269489 missense probably benign
IGL01719:Dpf3 APN 12 83294433 missense probably damaging 0.99
IGL01950:Dpf3 APN 12 83324949 missense probably benign 0.00
R0457:Dpf3 UTSW 12 83272405 missense probably damaging 0.96
R1104:Dpf3 UTSW 12 83331987 missense probably benign 0.30
R1565:Dpf3 UTSW 12 83370617 missense probably damaging 0.98
R1969:Dpf3 UTSW 12 83325035 critical splice acceptor site probably null
R1970:Dpf3 UTSW 12 83325035 critical splice acceptor site probably null
R1971:Dpf3 UTSW 12 83325035 critical splice acceptor site probably null
R2344:Dpf3 UTSW 12 83350820 missense probably damaging 1.00
R3732:Dpf3 UTSW 12 83269507 missense possibly damaging 0.90
R4828:Dpf3 UTSW 12 83294499 missense possibly damaging 0.89
R4936:Dpf3 UTSW 12 83331966 missense probably damaging 1.00
R4970:Dpf3 UTSW 12 83370611 nonsense probably null
R5112:Dpf3 UTSW 12 83370611 nonsense probably null
R5182:Dpf3 UTSW 12 83370596 missense probably damaging 0.99
R5638:Dpf3 UTSW 12 83324940 missense probably damaging 1.00
R5657:Dpf3 UTSW 12 83325011 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCTGAGTACAGATACCAGGAAAC -3'
(R):5'- AACTCTGGACTCTTCATCCTGG -3'

Sequencing Primer
(F):5'- TACAGATACCAGGAAACCAGGG -3'
(R):5'- ATCCTGGTTCCCAAGGATTAC -3'
Posted On2016-05-10