Incidental Mutation 'R4993:Dip2c'
ID385041
Institutional Source Beutler Lab
Gene Symbol Dip2c
Ensembl Gene ENSMUSG00000048264
Gene Namedisco interacting protein 2 homolog C
Synonyms2900024P20Rik
MMRRC Submission 042587-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.884) question?
Stock #R4993 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location9276528-9668928 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to G at 9575223 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 584 (Y584*)
Ref Sequence ENSEMBL: ENSMUSP00000133806 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166299] [ENSMUST00000169960] [ENSMUST00000174552]
Predicted Effect probably null
Transcript: ENSMUST00000166299
AA Change: Y584*
SMART Domains Protein: ENSMUSP00000126827
Gene: ENSMUSG00000048264
AA Change: Y584*

DomainStartEndE-ValueType
DMAP_binding 7 120 3.55e-43 SMART
low complexity region 170 187 N/A INTRINSIC
low complexity region 275 287 N/A INTRINSIC
Pfam:AMP-binding 324 801 3.6e-23 PFAM
Pfam:AMP-binding 977 1451 1.5e-72 PFAM
low complexity region 1514 1526 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169960
SMART Domains Protein: ENSMUSP00000131238
Gene: ENSMUSG00000048264

DomainStartEndE-ValueType
DMAP_binding 7 176 3.02e-37 SMART
low complexity region 226 243 N/A INTRINSIC
low complexity region 331 343 N/A INTRINSIC
Pfam:AMP-binding 380 637 5.9e-10 PFAM
SCOP:d1lci__ 675 875 2e-8 SMART
Pfam:AMP-binding 947 1421 1.2e-56 PFAM
low complexity region 1484 1496 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000174552
AA Change: Y584*
SMART Domains Protein: ENSMUSP00000133806
Gene: ENSMUSG00000048264
AA Change: Y584*

DomainStartEndE-ValueType
DMAP_binding 7 120 3.55e-43 SMART
low complexity region 170 187 N/A INTRINSIC
low complexity region 275 287 N/A INTRINSIC
Pfam:AMP-binding 324 800 2.7e-20 PFAM
Pfam:AMP-binding 976 1450 1.3e-56 PFAM
low complexity region 1513 1525 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disco-interacting protein homolog 2 family. The protein shares strong similarity with a Drosophila protein which interacts with the transcription factor disco and is expressed in the nervous system. [provided by RefSeq, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
9130008F23Rik G T 17: 40,880,161 Q126K probably benign Het
Abca15 C A 7: 120,401,718 N1492K probably damaging Het
Afap1l2 C T 19: 56,918,040 D402N probably damaging Het
Akap11 A G 14: 78,512,968 F660L probably damaging Het
Bcl3 T C 7: 19,820,177 T89A probably benign Het
Bub1b T C 2: 118,636,770 I858T possibly damaging Het
Cdk19 A G 10: 40,476,218 D288G possibly damaging Het
Cyp2d34 T A 15: 82,618,329 D202V probably damaging Het
Dpf3 A T 12: 83,331,861 probably null Het
Drp2 G A X: 134,441,316 R567H probably damaging Homo
Emid1 G T 11: 5,131,512 Q212K probably benign Het
Esm1 C T 13: 113,213,399 Q118* probably null Het
Fahd2a T G 2: 127,436,364 I308L probably benign Het
Fam208a T A 14: 27,429,114 W16R possibly damaging Het
Fanci T C 7: 79,435,378 *851Q probably null Het
Fastkd1 C A 2: 69,702,740 V428F probably damaging Het
Fat2 A T 11: 55,283,092 I2265N probably damaging Het
Gale C A 4: 135,966,860 H191Q probably damaging Het
Ghsr T A 3: 27,372,254 V153E possibly damaging Het
Gm10696 C T 3: 94,176,316 G63R probably damaging Het
Gpc6 A G 14: 117,624,539 N289S possibly damaging Het
Hoxb6 A T 11: 96,300,711 Y153F probably damaging Het
Ints3 T C 3: 90,415,507 T139A probably benign Het
Irf2bp2 A G 8: 126,592,671 S256P probably benign Het
Klf4 G T 4: 55,530,640 P148Q probably damaging Het
Loxl1 T G 9: 58,312,537 H117P probably damaging Het
Lpl A G 8: 68,895,793 K225E probably benign Het
Lrba T A 3: 86,360,037 V1678D probably damaging Het
Med1 A T 11: 98,163,904 F398Y probably damaging Het
Mfap2 T C 4: 141,015,578 *186Q probably null Het
Mfsd3 T C 15: 76,701,982 L105P probably damaging Het
Mlxip T G 5: 123,395,294 I122S probably damaging Het
Mmrn2 A T 14: 34,396,398 Y107F probably damaging Het
Mtg1 G T 7: 140,140,283 D88Y probably null Het
Mutyh T A 4: 116,817,935 S426R probably benign Het
Myo16 C T 8: 10,476,094 T878I probably damaging Het
Myo9a T A 9: 59,861,472 Y912* probably null Het
Ncor1 A C 11: 62,343,341 I669R probably damaging Het
Ndufs1 T C 1: 63,163,776 I210V probably benign Het
Nek9 A G 12: 85,310,420 C657R probably damaging Het
Noct C T 3: 51,250,021 T260I probably damaging Het
Nr1h4 A T 10: 89,498,180 M102K probably benign Het
Obscn G A 11: 59,124,761 R1054C possibly damaging Het
Olfr1124 T A 2: 87,435,152 F222I probably benign Het
Olfr352 C A 2: 36,869,988 Q141K probably benign Het
Olfr47 A G 6: 43,236,456 M283V possibly damaging Het
Olfr501-ps1 G A 7: 108,508,243 M62I probably damaging Het
Olfr615 T A 7: 103,561,317 I280N possibly damaging Het
Olfr619 A T 7: 103,603,656 M1L probably benign Het
Otol1 C A 3: 70,018,878 Q129K probably benign Het
Otx1 A T 11: 21,998,532 probably null Het
Pcdhac2 C A 18: 37,146,251 N761K probably damaging Het
Pde1c A T 6: 56,150,624 M452K probably damaging Het
Phkg2 T C 7: 127,573,941 Y24H probably damaging Het
Pigr G A 1: 130,841,817 D122N probably benign Het
Prg4 C T 1: 150,460,681 C97Y probably damaging Het
Ptdss1 T C 13: 66,945,288 V64A probably benign Het
Ralgapa2 T C 2: 146,447,311 K324E probably damaging Het
Rfx5 G A 3: 94,955,815 V73I probably benign Het
Riiad1 T C 3: 94,472,863 T42A probably benign Het
Rims2 T C 15: 39,454,445 V640A possibly damaging Het
Rnpep G T 1: 135,263,032 S592Y possibly damaging Het
Scap T C 9: 110,378,390 L431P probably damaging Het
Siglec1 T A 2: 131,073,361 I1437F possibly damaging Het
Skint1 T C 4: 112,028,333 probably null Het
Slc44a1 A G 4: 53,543,644 E396G probably damaging Het
Slc4a2 T C 5: 24,434,869 F521S probably damaging Het
Smarcc1 T A 9: 110,175,061 S394R probably damaging Het
Socs1 A G 16: 10,784,685 S63P probably benign Het
Sun1 T G 5: 139,225,333 S20A possibly damaging Het
Tac4 A T 11: 95,265,242 K50* probably null Het
Tcaf2 A G 6: 42,642,640 I151T probably damaging Het
Tcf4 T C 18: 69,681,769 V587A probably damaging Het
Ttc37 T A 13: 76,182,936 M1495K probably damaging Het
Ttn T A 2: 76,740,909 K24801* probably null Het
Tuba3b G T 6: 145,621,273 M413I possibly damaging Het
Ufl1 C T 4: 25,267,832 A280T possibly damaging Het
Ugt2b5 T A 5: 87,139,673 I212L probably benign Het
Umodl1 A G 17: 30,986,485 T685A probably benign Het
Uqcrc1 T A 9: 108,944,810 V183D probably damaging Het
Ush2a A G 1: 188,910,720 N4093S probably benign Het
Vmn1r167 C T 7: 23,505,228 S121N probably damaging Het
Vmn1r47 A G 6: 90,022,758 S291G possibly damaging Het
Vmn2r108 A G 17: 20,481,187 V17A probably benign Het
Vmn2r58 T A 7: 41,837,752 H573L probably benign Het
Xirp1 C T 9: 120,018,792 V342I probably damaging Het
Zfp462 A G 4: 55,051,204 M2226V possibly damaging Het
Zfp467 G A 6: 48,439,029 H230Y probably damaging Het
Zfp595 T A 13: 67,316,401 K599N probably damaging Het
Zfp819 C A 7: 43,617,296 T401K probably benign Het
Other mutations in Dip2c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Dip2c APN 13 9493108 missense probably damaging 0.97
IGL00426:Dip2c APN 13 9606515 missense probably damaging 1.00
IGL00503:Dip2c APN 13 9567898 missense probably damaging 1.00
IGL00586:Dip2c APN 13 9610755 missense probably damaging 1.00
IGL01306:Dip2c APN 13 9575143 missense possibly damaging 0.72
IGL01580:Dip2c APN 13 9637088 splice site probably null
IGL01985:Dip2c APN 13 9553267 splice site probably benign
IGL02060:Dip2c APN 13 9622630 missense probably damaging 0.98
IGL02122:Dip2c APN 13 9506659 missense possibly damaging 0.48
IGL02170:Dip2c APN 13 9606335 missense probably benign 0.03
IGL02211:Dip2c APN 13 9610847 missense probably damaging 1.00
IGL02755:Dip2c APN 13 9550320 critical splice donor site probably null
IGL02836:Dip2c APN 13 9610790 missense probably damaging 0.98
IGL02935:Dip2c APN 13 9662146 missense probably damaging 1.00
IGL03032:Dip2c APN 13 9551778 missense probably damaging 1.00
ANU23:Dip2c UTSW 13 9575143 missense possibly damaging 0.72
P0038:Dip2c UTSW 13 9646982 missense probably damaging 1.00
R0009:Dip2c UTSW 13 9621903 missense probably damaging 1.00
R0268:Dip2c UTSW 13 9637150 missense probably damaging 1.00
R0271:Dip2c UTSW 13 9615775 missense probably damaging 1.00
R0306:Dip2c UTSW 13 9604599 missense probably benign 0.09
R0415:Dip2c UTSW 13 9568289 splice site probably benign
R0519:Dip2c UTSW 13 9563208 missense probably damaging 1.00
R0557:Dip2c UTSW 13 9553459 missense possibly damaging 0.81
R0964:Dip2c UTSW 13 9568663 missense probably benign 0.43
R0973:Dip2c UTSW 13 9576908 missense probably damaging 0.99
R0973:Dip2c UTSW 13 9576908 missense probably damaging 0.99
R0974:Dip2c UTSW 13 9576908 missense probably damaging 0.99
R1101:Dip2c UTSW 13 9634744 missense probably damaging 1.00
R1171:Dip2c UTSW 13 9493126 missense possibly damaging 0.89
R1403:Dip2c UTSW 13 9553264 splice site probably null
R1403:Dip2c UTSW 13 9553264 splice site probably null
R1432:Dip2c UTSW 13 9553304 missense probably damaging 0.99
R1481:Dip2c UTSW 13 9551866 critical splice donor site probably null
R1588:Dip2c UTSW 13 9665864 missense probably damaging 1.00
R1721:Dip2c UTSW 13 9659368 missense probably damaging 1.00
R1726:Dip2c UTSW 13 9575428 missense probably damaging 1.00
R1867:Dip2c UTSW 13 9621949 missense possibly damaging 0.55
R1909:Dip2c UTSW 13 9533350 missense probably benign 0.00
R2013:Dip2c UTSW 13 9567846 nonsense probably null
R2022:Dip2c UTSW 13 9551800 missense probably damaging 1.00
R2517:Dip2c UTSW 13 9609005 missense probably damaging 1.00
R3746:Dip2c UTSW 13 9601473 missense probably damaging 1.00
R3794:Dip2c UTSW 13 9604561 missense probably damaging 0.99
R3884:Dip2c UTSW 13 9551858 missense probably damaging 1.00
R4019:Dip2c UTSW 13 9614365 missense probably damaging 0.99
R4110:Dip2c UTSW 13 9637101 missense probably damaging 1.00
R4111:Dip2c UTSW 13 9637101 missense probably damaging 1.00
R4113:Dip2c UTSW 13 9637101 missense probably damaging 1.00
R4256:Dip2c UTSW 13 9609056 missense probably damaging 1.00
R4300:Dip2c UTSW 13 9610711 missense probably damaging 1.00
R4494:Dip2c UTSW 13 9571062 missense possibly damaging 0.64
R4739:Dip2c UTSW 13 9533339 missense probably damaging 0.98
R4812:Dip2c UTSW 13 9637130 nonsense probably null
R4814:Dip2c UTSW 13 9536860 missense probably benign 0.07
R4816:Dip2c UTSW 13 9575150 missense probably benign 0.37
R4828:Dip2c UTSW 13 9560679 missense probably damaging 1.00
R4915:Dip2c UTSW 13 9621869 splice site probably null
R4917:Dip2c UTSW 13 9621869 splice site probably null
R4932:Dip2c UTSW 13 9623972 missense probably damaging 0.99
R5043:Dip2c UTSW 13 9551827 missense possibly damaging 0.80
R5349:Dip2c UTSW 13 9622653 missense probably damaging 1.00
R5744:Dip2c UTSW 13 9568405 missense probably damaging 1.00
R5840:Dip2c UTSW 13 9506676 missense possibly damaging 0.68
R6110:Dip2c UTSW 13 9623766 missense probably damaging 1.00
R6160:Dip2c UTSW 13 9533254 missense probably benign 0.01
R6161:Dip2c UTSW 13 9647007 missense probably damaging 1.00
R6477:Dip2c UTSW 13 9623760 missense probably damaging 1.00
R6522:Dip2c UTSW 13 9575228 critical splice donor site probably null
R6603:Dip2c UTSW 13 9654588 splice site probably null
R6658:Dip2c UTSW 13 9493177 critical splice donor site probably null
R6672:Dip2c UTSW 13 9567830 critical splice acceptor site probably null
R6697:Dip2c UTSW 13 9621913 missense probably damaging 1.00
R6991:Dip2c UTSW 13 9551860 nonsense probably null
R6991:Dip2c UTSW 13 9634832 missense probably damaging 1.00
R7018:Dip2c UTSW 13 9659278 missense probably damaging 1.00
R7053:Dip2c UTSW 13 9610704 missense probably damaging 1.00
R7102:Dip2c UTSW 13 9604536 missense probably benign 0.01
R7171:Dip2c UTSW 13 9506648 missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- AGTGCCTCCTTGAAGTGCTC -3'
(R):5'- CATGTCTCTTGATTTCACACAAGC -3'

Sequencing Primer
(F):5'- GAGCCTTGGCTTACATGTGTCC -3'
(R):5'- AAGCCACTTTTGCTACAAAGG -3'
Posted On2016-05-10