Incidental Mutation 'R4993:Akap11'
ID385048
Institutional Source Beutler Lab
Gene Symbol Akap11
Ensembl Gene ENSMUSG00000022016
Gene NameA kinase (PRKA) anchor protein 11
Synonyms6330501D17Rik
MMRRC Submission 042587-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4993 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location78492246-78536808 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 78512968 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 660 (F660L)
Ref Sequence ENSEMBL: ENSMUSP00000116015 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022593] [ENSMUST00000123853]
Predicted Effect probably damaging
Transcript: ENSMUST00000022593
AA Change: F660L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022593
Gene: ENSMUSG00000022016
AA Change: F660L

DomainStartEndE-ValueType
low complexity region 108 121 N/A INTRINSIC
low complexity region 170 179 N/A INTRINSIC
low complexity region 265 275 N/A INTRINSIC
low complexity region 302 318 N/A INTRINSIC
low complexity region 344 365 N/A INTRINSIC
low complexity region 528 539 N/A INTRINSIC
low complexity region 609 623 N/A INTRINSIC
low complexity region 727 741 N/A INTRINSIC
low complexity region 1161 1173 N/A INTRINSIC
low complexity region 1597 1614 N/A INTRINSIC
low complexity region 1631 1648 N/A INTRINSIC
low complexity region 1738 1755 N/A INTRINSIC
low complexity region 1767 1788 N/A INTRINSIC
Blast:AKAP_110 1790 1883 2e-8 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000123853
AA Change: F660L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116015
Gene: ENSMUSG00000022016
AA Change: F660L

DomainStartEndE-ValueType
low complexity region 108 121 N/A INTRINSIC
low complexity region 170 179 N/A INTRINSIC
low complexity region 265 275 N/A INTRINSIC
low complexity region 302 318 N/A INTRINSIC
low complexity region 344 365 N/A INTRINSIC
low complexity region 528 539 N/A INTRINSIC
low complexity region 609 623 N/A INTRINSIC
low complexity region 727 741 N/A INTRINSIC
low complexity region 1161 1173 N/A INTRINSIC
low complexity region 1597 1614 N/A INTRINSIC
low complexity region 1631 1648 N/A INTRINSIC
low complexity region 1731 1756 N/A INTRINSIC
low complexity region 1768 1789 N/A INTRINSIC
Blast:AKAP_110 1791 1884 2e-8 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226416
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227722
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The A-kinase anchor proteins (AKAPs) are a group of structurally diverse proteins, which have the common function of binding to the regulatory subunit of protein kinase A (PKA) and confining the holoenzyme to discrete locations within the cell. This gene encodes a member of the AKAP family. The encoded protein is expressed at high levels throughout spermatogenesis and in mature sperm. It binds the RI and RII subunits of PKA in testis. It may serve a function in cell cycle control of both somatic cells and germ cells in addition to its putative role in spermatogenesis and sperm function. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show a reduction in body size, body length and tibia length, hypoactivity, slow movement and increased anxiety-related responses, and exhibit actin barrier defects in kidney collecting duct cells and increased urine osmolality in response to overhydration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
9130008F23Rik G T 17: 40,880,161 Q126K probably benign Het
Abca15 C A 7: 120,401,718 N1492K probably damaging Het
Afap1l2 C T 19: 56,918,040 D402N probably damaging Het
Bcl3 T C 7: 19,820,177 T89A probably benign Het
Bub1b T C 2: 118,636,770 I858T possibly damaging Het
Cdk19 A G 10: 40,476,218 D288G possibly damaging Het
Cyp2d34 T A 15: 82,618,329 D202V probably damaging Het
Dip2c T G 13: 9,575,223 Y584* probably null Het
Dpf3 A T 12: 83,331,861 probably null Het
Drp2 G A X: 134,441,316 R567H probably damaging Homo
Emid1 G T 11: 5,131,512 Q212K probably benign Het
Esm1 C T 13: 113,213,399 Q118* probably null Het
Fahd2a T G 2: 127,436,364 I308L probably benign Het
Fam208a T A 14: 27,429,114 W16R possibly damaging Het
Fanci T C 7: 79,435,378 *851Q probably null Het
Fastkd1 C A 2: 69,702,740 V428F probably damaging Het
Fat2 A T 11: 55,283,092 I2265N probably damaging Het
Gale C A 4: 135,966,860 H191Q probably damaging Het
Ghsr T A 3: 27,372,254 V153E possibly damaging Het
Gm10696 C T 3: 94,176,316 G63R probably damaging Het
Gpc6 A G 14: 117,624,539 N289S possibly damaging Het
Hoxb6 A T 11: 96,300,711 Y153F probably damaging Het
Ints3 T C 3: 90,415,507 T139A probably benign Het
Irf2bp2 A G 8: 126,592,671 S256P probably benign Het
Klf4 G T 4: 55,530,640 P148Q probably damaging Het
Loxl1 T G 9: 58,312,537 H117P probably damaging Het
Lpl A G 8: 68,895,793 K225E probably benign Het
Lrba T A 3: 86,360,037 V1678D probably damaging Het
Med1 A T 11: 98,163,904 F398Y probably damaging Het
Mfap2 T C 4: 141,015,578 *186Q probably null Het
Mfsd3 T C 15: 76,701,982 L105P probably damaging Het
Mlxip T G 5: 123,395,294 I122S probably damaging Het
Mmrn2 A T 14: 34,396,398 Y107F probably damaging Het
Mtg1 G T 7: 140,140,283 D88Y probably null Het
Mutyh T A 4: 116,817,935 S426R probably benign Het
Myo16 C T 8: 10,476,094 T878I probably damaging Het
Myo9a T A 9: 59,861,472 Y912* probably null Het
Ncor1 A C 11: 62,343,341 I669R probably damaging Het
Ndufs1 T C 1: 63,163,776 I210V probably benign Het
Nek9 A G 12: 85,310,420 C657R probably damaging Het
Noct C T 3: 51,250,021 T260I probably damaging Het
Nr1h4 A T 10: 89,498,180 M102K probably benign Het
Obscn G A 11: 59,124,761 R1054C possibly damaging Het
Olfr1124 T A 2: 87,435,152 F222I probably benign Het
Olfr352 C A 2: 36,869,988 Q141K probably benign Het
Olfr47 A G 6: 43,236,456 M283V possibly damaging Het
Olfr501-ps1 G A 7: 108,508,243 M62I probably damaging Het
Olfr615 T A 7: 103,561,317 I280N possibly damaging Het
Olfr619 A T 7: 103,603,656 M1L probably benign Het
Otol1 C A 3: 70,018,878 Q129K probably benign Het
Otx1 A T 11: 21,998,532 probably null Het
Pcdhac2 C A 18: 37,146,251 N761K probably damaging Het
Pde1c A T 6: 56,150,624 M452K probably damaging Het
Phkg2 T C 7: 127,573,941 Y24H probably damaging Het
Pigr G A 1: 130,841,817 D122N probably benign Het
Prg4 C T 1: 150,460,681 C97Y probably damaging Het
Ptdss1 T C 13: 66,945,288 V64A probably benign Het
Ralgapa2 T C 2: 146,447,311 K324E probably damaging Het
Rfx5 G A 3: 94,955,815 V73I probably benign Het
Riiad1 T C 3: 94,472,863 T42A probably benign Het
Rims2 T C 15: 39,454,445 V640A possibly damaging Het
Rnpep G T 1: 135,263,032 S592Y possibly damaging Het
Scap T C 9: 110,378,390 L431P probably damaging Het
Siglec1 T A 2: 131,073,361 I1437F possibly damaging Het
Skint1 T C 4: 112,028,333 probably null Het
Slc44a1 A G 4: 53,543,644 E396G probably damaging Het
Slc4a2 T C 5: 24,434,869 F521S probably damaging Het
Smarcc1 T A 9: 110,175,061 S394R probably damaging Het
Socs1 A G 16: 10,784,685 S63P probably benign Het
Sun1 T G 5: 139,225,333 S20A possibly damaging Het
Tac4 A T 11: 95,265,242 K50* probably null Het
Tcaf2 A G 6: 42,642,640 I151T probably damaging Het
Tcf4 T C 18: 69,681,769 V587A probably damaging Het
Ttc37 T A 13: 76,182,936 M1495K probably damaging Het
Ttn T A 2: 76,740,909 K24801* probably null Het
Tuba3b G T 6: 145,621,273 M413I possibly damaging Het
Ufl1 C T 4: 25,267,832 A280T possibly damaging Het
Ugt2b5 T A 5: 87,139,673 I212L probably benign Het
Umodl1 A G 17: 30,986,485 T685A probably benign Het
Uqcrc1 T A 9: 108,944,810 V183D probably damaging Het
Ush2a A G 1: 188,910,720 N4093S probably benign Het
Vmn1r167 C T 7: 23,505,228 S121N probably damaging Het
Vmn1r47 A G 6: 90,022,758 S291G possibly damaging Het
Vmn2r108 A G 17: 20,481,187 V17A probably benign Het
Vmn2r58 T A 7: 41,837,752 H573L probably benign Het
Xirp1 C T 9: 120,018,792 V342I probably damaging Het
Zfp462 A G 4: 55,051,204 M2226V possibly damaging Het
Zfp467 G A 6: 48,439,029 H230Y probably damaging Het
Zfp595 T A 13: 67,316,401 K599N probably damaging Het
Zfp819 C A 7: 43,617,296 T401K probably benign Het
Other mutations in Akap11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Akap11 APN 14 78511341 missense probably damaging 1.00
IGL00902:Akap11 APN 14 78495838 missense probably benign 0.11
IGL01752:Akap11 APN 14 78509878 critical splice donor site probably null
IGL01972:Akap11 APN 14 78507857 missense probably damaging 0.99
IGL02031:Akap11 APN 14 78513813 missense possibly damaging 0.50
IGL02239:Akap11 APN 14 78513849 missense probably damaging 1.00
IGL02528:Akap11 APN 14 78510867 missense probably damaging 1.00
IGL02884:Akap11 APN 14 78498962 missense probably benign 0.02
IGL03130:Akap11 APN 14 78510368 nonsense probably null
IGL03179:Akap11 APN 14 78507740 missense probably benign 0.00
IGL03240:Akap11 APN 14 78495905 missense probably damaging 0.99
IGL03331:Akap11 APN 14 78513865 missense probably damaging 1.00
bonham UTSW 14 78498864 nonsense probably null
R0004:Akap11 UTSW 14 78514940 missense possibly damaging 0.65
R0020:Akap11 UTSW 14 78518177 missense probably benign 0.37
R0200:Akap11 UTSW 14 78510753 missense probably benign 0.00
R0281:Akap11 UTSW 14 78510089 missense possibly damaging 0.84
R0320:Akap11 UTSW 14 78513379 missense probably benign
R0381:Akap11 UTSW 14 78513550 missense probably benign 0.01
R0536:Akap11 UTSW 14 78514024 missense probably damaging 1.00
R0608:Akap11 UTSW 14 78510753 missense probably benign 0.00
R0735:Akap11 UTSW 14 78510078 missense probably damaging 1.00
R1189:Akap11 UTSW 14 78513347 missense probably benign 0.11
R1400:Akap11 UTSW 14 78513962 missense probably damaging 1.00
R1406:Akap11 UTSW 14 78512749 missense probably benign
R1406:Akap11 UTSW 14 78512749 missense probably benign
R1501:Akap11 UTSW 14 78513347 missense probably benign 0.11
R1588:Akap11 UTSW 14 78510245 missense possibly damaging 0.50
R1717:Akap11 UTSW 14 78513348 missense probably benign 0.02
R1823:Akap11 UTSW 14 78511488 missense probably damaging 1.00
R1847:Akap11 UTSW 14 78513661 missense probably benign 0.00
R1874:Akap11 UTSW 14 78511866 missense probably benign 0.14
R2031:Akap11 UTSW 14 78510037 missense possibly damaging 0.86
R2032:Akap11 UTSW 14 78510037 missense possibly damaging 0.86
R2276:Akap11 UTSW 14 78510037 missense possibly damaging 0.86
R2763:Akap11 UTSW 14 78518892 missense probably damaging 0.98
R4483:Akap11 UTSW 14 78510259 missense probably damaging 1.00
R4582:Akap11 UTSW 14 78511929 missense possibly damaging 0.81
R4857:Akap11 UTSW 14 78498860 missense probably damaging 0.99
R4922:Akap11 UTSW 14 78512780 nonsense probably null
R5426:Akap11 UTSW 14 78498864 nonsense probably null
R5472:Akap11 UTSW 14 78513429 missense probably benign 0.03
R5683:Akap11 UTSW 14 78512578 missense probably damaging 0.98
R5774:Akap11 UTSW 14 78510967 missense probably damaging 1.00
R6014:Akap11 UTSW 14 78512499 missense probably benign 0.00
R6264:Akap11 UTSW 14 78512421 missense possibly damaging 0.68
R6270:Akap11 UTSW 14 78518799 missense probably damaging 1.00
R6319:Akap11 UTSW 14 78513538 missense probably benign 0.06
R6376:Akap11 UTSW 14 78514896 missense probably damaging 1.00
R6394:Akap11 UTSW 14 78522589 critical splice donor site probably null
R6536:Akap11 UTSW 14 78511314 missense possibly damaging 0.81
R7048:Akap11 UTSW 14 78512514 missense
R7147:Akap11 UTSW 14 78511465 missense
Predicted Primers PCR Primer
(F):5'- GCGTAGGTGATACACTTTCTGC -3'
(R):5'- GCATTTTCACTAAAAGAACGAGCC -3'

Sequencing Primer
(F):5'- GTAGGTGATACACTTTCTGCACTCAC -3'
(R):5'- AACGAGCCATTGGTAGCCTG -3'
Posted On2016-05-10