Incidental Mutation 'R4994:Trnt1'
ID385092
Institutional Source Beutler Lab
Gene Symbol Trnt1
Ensembl Gene ENSMUSG00000013736
Gene NametRNA nucleotidyl transferase, CCA-adding, 1
SynonymsCGI-47, 2410043H24Rik, 2610044E04Rik
MMRRC Submission 042588-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.965) question?
Stock #R4994 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location106769120-106782474 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 106778892 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 303 (Q303*)
Ref Sequence ENSEMBL: ENSMUSP00000108875 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013882] [ENSMUST00000057578] [ENSMUST00000113239] [ENSMUST00000113247] [ENSMUST00000113248] [ENSMUST00000113249] [ENSMUST00000151484] [ENSMUST00000204782]
Predicted Effect probably benign
Transcript: ENSMUST00000013882
SMART Domains Protein: ENSMUSP00000013882
Gene: ENSMUSG00000005362

DomainStartEndE-ValueType
low complexity region 23 39 N/A INTRINSIC
LON 82 319 2.33e-41 SMART
Predicted Effect probably null
Transcript: ENSMUST00000057578
AA Change: Q303*
SMART Domains Protein: ENSMUSP00000060900
Gene: ENSMUSG00000013736
AA Change: Q303*

DomainStartEndE-ValueType
Pfam:PolyA_pol 59 182 3.8e-36 PFAM
Pfam:PolyA_pol_RNAbd 215 271 1.4e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113239
SMART Domains Protein: ENSMUSP00000108865
Gene: ENSMUSG00000005362

DomainStartEndE-ValueType
low complexity region 24 40 N/A INTRINSIC
LON 83 320 2.33e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113247
SMART Domains Protein: ENSMUSP00000108873
Gene: ENSMUSG00000013736

DomainStartEndE-ValueType
Pfam:PolyA_pol 59 182 7.7e-37 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000113248
AA Change: Q303*
SMART Domains Protein: ENSMUSP00000108874
Gene: ENSMUSG00000013736
AA Change: Q303*

DomainStartEndE-ValueType
Pfam:PolyA_pol 59 182 2.4e-37 PFAM
Pfam:PolyA_pol_RNAbd 215 272 9.3e-15 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000113249
AA Change: Q303*
SMART Domains Protein: ENSMUSP00000108875
Gene: ENSMUSG00000013736
AA Change: Q303*

DomainStartEndE-ValueType
Pfam:PolyA_pol 59 182 3.8e-36 PFAM
Pfam:PolyA_pol_RNAbd 215 271 1.4e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151484
SMART Domains Protein: ENSMUSP00000144723
Gene: ENSMUSG00000005362

DomainStartEndE-ValueType
low complexity region 11 27 N/A INTRINSIC
LON 70 253 3.1e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000204782
SMART Domains Protein: ENSMUSP00000144850
Gene: ENSMUSG00000013736

DomainStartEndE-ValueType
Pfam:PolyA_pol 59 134 3e-17 PFAM
Meta Mutation Damage Score 0.582 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a CCA-adding enzyme which belongs to the tRNA nucleotidyltransferase/poly(A) polymerase family. This essential enzyme functions by catalyzing the addition of the conserved nucleotide triplet CCA to the 3' terminus of tRNA molecules. Mutations in this gene result in sideroblastic anemia with B-cell immunodeficiency, periodic fevers, and developmental delay. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190002N15Rik C A 9: 94,537,433 R148L probably benign Het
1700030K09Rik A G 8: 72,455,118 E364G probably benign Het
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
Abcb4 A G 5: 8,928,524 T557A probably damaging Het
Acadm C T 3: 153,929,584 E298K probably damaging Het
Adrb3 T C 8: 27,227,827 probably null Het
Aldh1b1 A G 4: 45,803,128 Y222C possibly damaging Het
Ankrd6 A G 4: 32,860,387 Y19H probably damaging Het
Arhgap21 T A 2: 20,849,890 T1554S probably benign Het
BC043934 T C 9: 96,437,120 noncoding transcript Het
Birc6 A G 17: 74,594,324 probably benign Het
Blm A C 7: 80,458,825 F1357C probably benign Het
Cd209a T C 8: 3,747,713 probably null Het
Cdk7 G A 13: 100,717,595 H129Y probably damaging Het
Clec14a G T 12: 58,268,284 P184Q probably damaging Het
Cma1 T A 14: 55,941,671 I243F probably damaging Het
Cntnap3 G T 13: 64,761,984 T769K possibly damaging Het
Col5a1 A C 2: 28,032,739 K273T possibly damaging Het
Csnk1e A G 15: 79,424,929 Y266H probably damaging Het
Cyb5d1 A G 11: 69,393,771 L185S probably damaging Het
Dennd5b T C 6: 149,041,500 probably null Het
Drp2 G A X: 134,441,316 R567H probably damaging Homo
Dzank1 T G 2: 144,522,566 D37A probably damaging Het
Echdc2 A G 4: 108,165,628 I34V probably benign Het
Esm1 A T 13: 113,213,431 R128S probably benign Het
Fbrsl1 A G 5: 110,447,951 S73P probably damaging Het
Fbxo18 T A 2: 11,764,230 I251F probably damaging Het
Fbxo6 A T 4: 148,149,491 S49R probably damaging Het
Gm13089 T A 4: 143,698,369 Q168L possibly damaging Het
Gm17093 A T 14: 44,519,322 Q82L probably damaging Het
Hmcn2 T C 2: 31,458,055 probably null Het
Hspa4l C A 3: 40,745,649 probably benign Het
Il3ra G A 14: 14,351,080 A201T probably benign Het
Irx5 T A 8: 92,360,781 V447E probably damaging Het
Kif14 G T 1: 136,482,959 L668F probably damaging Het
Lag3 T A 6: 124,904,453 R519W unknown Het
Lgr4 A G 2: 110,011,938 N756S probably damaging Het
Lingo4 A G 3: 94,402,541 H262R probably benign Het
Lingo4 T A 3: 94,403,001 H415Q probably benign Het
Lkaaear1 C A 2: 181,697,583 G25* probably null Het
Marf1 T C 16: 14,114,231 K1641E probably benign Het
Mtfmt T C 9: 65,443,851 probably benign Het
Mtif3 G A 5: 146,956,788 T203M probably benign Het
Mycbp2 A G 14: 103,169,994 I2740T probably benign Het
Nrd1 A G 4: 109,046,612 T720A probably benign Het
Olfr715 T C 7: 107,129,064 T110A probably benign Het
Peak1 T A 9: 56,241,276 D32V possibly damaging Het
Pigr G A 1: 130,841,817 D122N probably benign Het
Plekhg3 A G 12: 76,565,537 R391G possibly damaging Het
Ppfia3 T C 7: 45,341,118 D919G probably damaging Het
Rnase2b T A 14: 51,162,751 D96E possibly damaging Het
Rsf1 CGGCGGC CGGCGGCCGCGGCGGC 7: 97,579,923 probably benign Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Het
Serpina3f A G 12: 104,220,356 T394A probably benign Het
Six3 A G 17: 85,621,292 N18S possibly damaging Het
Slc12a5 T A 2: 164,983,365 probably null Het
Slc35f6 A G 5: 30,648,083 N21S probably damaging Het
Slc39a6 A T 18: 24,596,294 I454N probably damaging Het
Slc40a1 T A 1: 45,909,664 E485D probably damaging Het
Sort1 G A 3: 108,328,069 C255Y probably damaging Het
Stab2 T A 10: 86,949,907 T624S probably benign Het
Stk33 T A 7: 109,340,398 I99L probably benign Het
Taf4b T A 18: 14,898,043 I828N probably damaging Het
Terf2 T C 8: 107,076,478 probably benign Het
Timd4 C T 11: 46,815,517 R49C probably damaging Het
Tmem57 A G 4: 134,828,299 Y288H probably damaging Het
Tpte T C 8: 22,318,346 S166P probably benign Het
Trabd2b T C 4: 114,406,855 L13P probably benign Het
Trappc11 A T 8: 47,522,441 Y247* probably null Het
Tspyl5 T A 15: 33,687,055 Q248L possibly damaging Het
Ubxn7 A T 16: 32,381,504 K337N probably damaging Het
Unc13a T A 8: 71,643,172 I1234F probably benign Het
Vmn1r127 A T 7: 21,319,018 F282I probably damaging Het
Wdhd1 A T 14: 47,268,654 probably null Het
Zfp605 A G 5: 110,127,486 K157E probably damaging Het
Zhx2 T A 15: 57,821,359 D41E probably benign Het
Other mutations in Trnt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00819:Trnt1 APN 6 106776222 nonsense probably null
IGL00915:Trnt1 APN 6 106779426 missense probably benign 0.00
IGL01821:Trnt1 APN 6 106774475 missense probably damaging 1.00
IGL02102:Trnt1 APN 6 106778112 critical splice donor site probably null
IGL02610:Trnt1 APN 6 106778818 missense possibly damaging 0.88
IGL02933:Trnt1 APN 6 106773426 missense probably benign 0.40
R0606:Trnt1 UTSW 6 106777908 unclassified probably benign
R0844:Trnt1 UTSW 6 106774503 missense probably damaging 1.00
R2144:Trnt1 UTSW 6 106778039 missense probably damaging 1.00
R2495:Trnt1 UTSW 6 106773369 missense possibly damaging 0.88
R5294:Trnt1 UTSW 6 106773414 missense probably damaging 1.00
R5742:Trnt1 UTSW 6 106778917 nonsense probably null
R6855:Trnt1 UTSW 6 106777922 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCTGCTACAGGAAACAGG -3'
(R):5'- TGCTCAGACCTAATACATACTTACGTC -3'

Sequencing Primer
(F):5'- CTTCTAGGAGTTAAGGGAGTGAC -3'
(R):5'- CGTCTATCACAAAGTCTTGGTATGG -3'
Posted On2016-05-10