Mutagenetix > Incidental Mutation

Incidental Mutation 'R4994:Cd209a'

385101

Institutional Source

Beutler Lab

Gene Symbol

Cd209a

Ensembl Gene

ENSMUSG00000031494

Gene Name

CD209a antigen

Synonyms

CIRE, Dcsign, DC-SIGN, SIGNR5, CD209, DC-SIGN1

MMRRC Submission

042588-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4994 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

3793397-3798984 bp(-) (GRCm39)

Type of Mutation

critical splice acceptor site

DNA Base Change (assembly)

T to C at 3797713 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000146627 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000012847] [ENSMUST00000207979] [ENSMUST00000208960]

AlphaFold

Q91ZX1

Predicted Effect

probably null
Transcript: ENSMUST00000012847

SMART Domains

Protein: ENSMUSP00000012847
Gene: ENSMUSG00000031494

Domain	Start	End	E-Value	Type
transmembrane domain	54	76	N/A	INTRINSIC
CLECT	108	229	2.79e-32	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000207906

Predicted Effect

probably benign
Transcript: ENSMUST00000207979

Predicted Effect

probably null
Transcript: ENSMUST00000208960

Meta Mutation Damage Score

0.9234

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.0%

Validation Efficiency

100% (79/79)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane receptor and is often referred to as L-SIGN because of its expression in the endothelial cells of the lymph nodes and liver. The encoded protein is involved in the innate immune system and recognizes numerous evolutionarily divergent pathogens ranging from parasites to viruses, with a large impact on public health. The protein is organized into three distinct domains: an N-terminal transmembrane domain, a tandem-repeat neck domain and C-type lectin carbohydrate recognition domain. The extracellular region consisting of the C-type lectin and neck domains has a dual function as a pathogen recognition receptor and a cell adhesion receptor by binding carbohydrate ligands on the surface of microbes and endogenous cells. The neck region is important for homo-oligomerization which allows the receptor to bind multivalent ligands with high avidity. Variations in the number of 23 amino acid repeats in the neck domain of this protein are common and have a significant impact on ligand binding ability. This gene is closely related in terms of both sequence and function to a neighboring gene (GeneID 30835; often referred to as DC-SIGN or CD209). DC-SIGN and L-SIGN differ in their ligand-binding properties and distribution. Alternative splicing results in multiple variants.[provided by RefSeq, Feb 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal susceptibility to bacterial infection despite altered lymphocyte numbers and increased inflammatory response.. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700030K09Rik	A	G	8: 73,208,962 (GRCm39)	E364G	probably benign	Het
4930505A04Rik	C	T	11: 30,376,349 (GRCm39)	V173M	probably damaging	Het
Abcb4	A	G	5: 8,978,524 (GRCm39)	T557A	probably damaging	Het
Acadm	C	T	3: 153,635,221 (GRCm39)	E298K	probably damaging	Het
Adrb3	T	C	8: 27,717,855 (GRCm39)		probably null	Het
Aldh1b1	A	G	4: 45,803,128 (GRCm39)	Y222C	possibly damaging	Het
Ankrd6	A	G	4: 32,860,387 (GRCm39)	Y19H	probably damaging	Het
Arhgap21	T	A	2: 20,854,701 (GRCm39)	T1554S	probably benign	Het
BC043934	T	C	9: 96,319,173 (GRCm39)		noncoding transcript	Het
Birc6	A	G	17: 74,901,319 (GRCm39)		probably benign	Het
Blm	A	C	7: 80,108,573 (GRCm39)	F1357C	probably benign	Het
Cdk7	G	A	13: 100,854,103 (GRCm39)	H129Y	probably damaging	Het
Clec14a	G	T	12: 58,315,070 (GRCm39)	P184Q	probably damaging	Het
Cma1	T	A	14: 56,179,128 (GRCm39)	I243F	probably damaging	Het
Cntnap3	G	T	13: 64,909,798 (GRCm39)	T769K	possibly damaging	Het
Col5a1	A	C	2: 27,922,751 (GRCm39)	K273T	possibly damaging	Het
Csnk1e	A	G	15: 79,309,129 (GRCm39)	Y266H	probably damaging	Het
Cyb5d1	A	G	11: 69,284,597 (GRCm39)	L185S	probably damaging	Het
Dennd5b	T	C	6: 148,942,998 (GRCm39)		probably null	Het
Dipk2a	C	A	9: 94,419,486 (GRCm39)	R148L	probably benign	Het
Drp2	G	A	X: 133,342,065 (GRCm39)	R567H	probably damaging	Homo
Dzank1	T	G	2: 144,364,486 (GRCm39)	D37A	probably damaging	Het
Echdc2	A	G	4: 108,022,825 (GRCm39)	I34V	probably benign	Het
Esm1	A	T	13: 113,349,965 (GRCm39)	R128S	probably benign	Het
Fbh1	T	A	2: 11,769,041 (GRCm39)	I251F	probably damaging	Het
Fbrsl1	A	G	5: 110,595,817 (GRCm39)	S73P	probably damaging	Het
Fbxo6	A	T	4: 148,233,948 (GRCm39)	S49R	probably damaging	Het
Gm17093	A	T	14: 44,756,779 (GRCm39)	Q82L	probably damaging	Het
Hmcn2	T	C	2: 31,348,067 (GRCm39)		probably null	Het
Hspa4l	C	A	3: 40,700,081 (GRCm39)		probably benign	Het
Il3ra	G	A	14: 14,351,080 (GRCm38)	A201T	probably benign	Het
Irx5	T	A	8: 93,087,409 (GRCm39)	V447E	probably damaging	Het
Kif14	G	T	1: 136,410,697 (GRCm39)	L668F	probably damaging	Het
Lag3	T	A	6: 124,881,416 (GRCm39)	R519W	unknown	Het
Lgr4	A	G	2: 109,842,283 (GRCm39)	N756S	probably damaging	Het
Lingo4	A	G	3: 94,309,848 (GRCm39)	H262R	probably benign	Het
Lingo4	T	A	3: 94,310,308 (GRCm39)	H415Q	probably benign	Het
Lkaaear1	C	A	2: 181,339,376 (GRCm39)	G25*	probably null	Het
Maco1	A	G	4: 134,555,610 (GRCm39)	Y288H	probably damaging	Het
Marf1	T	C	16: 13,932,095 (GRCm39)	K1641E	probably benign	Het
Mtfmt	T	C	9: 65,351,133 (GRCm39)		probably benign	Het
Mtif3	G	A	5: 146,893,598 (GRCm39)	T203M	probably benign	Het
Mycbp2	A	G	14: 103,407,430 (GRCm39)	I2740T	probably benign	Het
Nrdc	A	G	4: 108,903,809 (GRCm39)	T720A	probably benign	Het
Or2d2	T	C	7: 106,728,271 (GRCm39)	T110A	probably benign	Het
Peak1	T	A	9: 56,148,560 (GRCm39)	D32V	possibly damaging	Het
Pigr	G	A	1: 130,769,554 (GRCm39)	D122N	probably benign	Het
Plekhg3	A	G	12: 76,612,311 (GRCm39)	R391G	possibly damaging	Het
Ppfia3	T	C	7: 44,990,542 (GRCm39)	D919G	probably damaging	Het
Pramel23	T	A	4: 143,424,939 (GRCm39)	Q168L	possibly damaging	Het
Rnase2b	T	A	14: 51,400,208 (GRCm39)	D96E	possibly damaging	Het
Rsf1	CGGCGGC	CGGCGGCCGCGGCGGC	7: 97,229,130 (GRCm39)		probably benign	Het
Rsf1	G	GACGGCGGCT	7: 97,229,116 (GRCm39)		probably benign	Het
Serpina3f	A	G	12: 104,186,615 (GRCm39)	T394A	probably benign	Het
Six3	A	G	17: 85,928,720 (GRCm39)	N18S	possibly damaging	Het
Slc12a5	T	A	2: 164,825,285 (GRCm39)		probably null	Het
Slc35f6	A	G	5: 30,805,427 (GRCm39)	N21S	probably damaging	Het
Slc39a6	A	T	18: 24,729,351 (GRCm39)	I454N	probably damaging	Het
Slc40a1	T	A	1: 45,948,824 (GRCm39)	E485D	probably damaging	Het
Sort1	G	A	3: 108,235,385 (GRCm39)	C255Y	probably damaging	Het
Stab2	T	A	10: 86,785,771 (GRCm39)	T624S	probably benign	Het
Stk33	T	A	7: 108,939,605 (GRCm39)	I99L	probably benign	Het
Taf4b	T	A	18: 15,031,100 (GRCm39)	I828N	probably damaging	Het
Terf2	T	C	8: 107,803,110 (GRCm39)		probably benign	Het
Timd4	C	T	11: 46,706,344 (GRCm39)	R49C	probably damaging	Het
Tpte	T	C	8: 22,808,362 (GRCm39)	S166P	probably benign	Het
Trabd2b	T	C	4: 114,264,052 (GRCm39)	L13P	probably benign	Het
Trappc11	A	T	8: 47,975,476 (GRCm39)	Y247*	probably null	Het
Trnt1	C	T	6: 106,755,853 (GRCm39)	Q303*	probably null	Het
Tspyl5	T	A	15: 33,687,201 (GRCm39)	Q248L	possibly damaging	Het
Ubxn7	A	T	16: 32,200,322 (GRCm39)	K337N	probably damaging	Het
Unc13a	T	A	8: 72,095,816 (GRCm39)	I1234F	probably benign	Het
Vmn1r127	A	T	7: 21,052,943 (GRCm39)	F282I	probably damaging	Het
Wdhd1	A	T	14: 47,506,111 (GRCm39)		probably null	Het
Zfp605	A	G	5: 110,275,352 (GRCm39)	K157E	probably damaging	Het
Zhx2	T	A	15: 57,684,755 (GRCm39)	D41E	probably benign	Het

Other mutations in Cd209a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01823:Cd209a	APN	8	3,798,851 (GRCm39)	splice site	probably benign
IGL02216:Cd209a	APN	8	3,795,576 (GRCm39)	missense	probably damaging	1.00
R0306:Cd209a	UTSW	8	3,795,535 (GRCm39)	missense	probably benign
R0696:Cd209a	UTSW	8	3,798,384 (GRCm39)	missense	possibly damaging	0.65
R1818:Cd209a	UTSW	8	3,795,576 (GRCm39)	missense	probably damaging	0.99
R4517:Cd209a	UTSW	8	3,795,525 (GRCm39)	missense	probably damaging	1.00
R5913:Cd209a	UTSW	8	3,798,742 (GRCm39)	missense	probably benign	0.00
R6475:Cd209a	UTSW	8	3,797,031 (GRCm39)	missense	probably damaging	0.99
R7372:Cd209a	UTSW	8	3,798,857 (GRCm39)	splice site	probably null
R7557:Cd209a	UTSW	8	3,795,541 (GRCm39)	missense	probably benign	0.11
R7570:Cd209a	UTSW	8	3,794,151 (GRCm39)	missense	probably damaging	1.00
R8898:Cd209a	UTSW	8	3,798,739 (GRCm39)	missense	probably damaging	1.00
R9165:Cd209a	UTSW	8	3,795,602 (GRCm39)	missense	probably damaging	1.00
Z1088:Cd209a	UTSW	8	3,797,017 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTCCATCCCACAGGTTAGG -3'
(R):5'- AGACCTTGGGTTTTGAAAATGATGC -3'

Sequencing Primer
(F):5'- ATCCCACAGGTTAGGGACGTG -3'
(R):5'- GTGGTAGAATGCTTACCTCACAAGC -3'

Posted On

2016-05-10