Incidental Mutation 'R0374:Phlpp2'
ID38521
Institutional Source Beutler Lab
Gene Symbol Phlpp2
Ensembl Gene ENSMUSG00000031732
Gene NamePH domain and leucine rich repeat protein phosphatase 2
SynonymsC130044A18Rik, Phlppl
MMRRC Submission 038580-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.203) question?
Stock #R0374 (G1)
Quality Score188
Status Validated
Chromosome8
Chromosomal Location109868542-109944671 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 109907513 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 242 (R242W)
Ref Sequence ENSEMBL: ENSMUSP00000136166 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034175] [ENSMUST00000179721]
Predicted Effect probably damaging
Transcript: ENSMUST00000034175
AA Change: R207W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034175
Gene: ENSMUSG00000031732
AA Change: R207W

DomainStartEndE-ValueType
low complexity region 40 57 N/A INTRINSIC
Blast:PH 148 247 3e-61 BLAST
LRR 295 314 1.12e2 SMART
Pfam:LRR_7 319 335 3.5e-2 PFAM
LRR 341 363 2.82e0 SMART
LRR 364 387 9.75e0 SMART
LRR 456 479 2.68e1 SMART
LRR 498 517 1.35e1 SMART
LRR 521 540 5.59e1 SMART
LRR 544 563 2.79e1 SMART
LRR 569 589 1.62e1 SMART
LRR 590 609 1.67e1 SMART
LRR 616 641 1.33e2 SMART
LRR 640 659 1.4e1 SMART
LRR_TYP 664 687 6.78e-3 SMART
LRR 709 733 2.15e2 SMART
PP2Cc 772 1028 2.98e-30 SMART
low complexity region 1061 1095 N/A INTRINSIC
Blast:PP2Cc 1109 1175 8e-15 BLAST
low complexity region 1297 1315 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154262
Predicted Effect probably damaging
Transcript: ENSMUST00000179721
AA Change: R242W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136166
Gene: ENSMUSG00000031732
AA Change: R242W

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
low complexity region 75 92 N/A INTRINSIC
Blast:PH 183 282 4e-61 BLAST
LRR 330 349 1.12e2 SMART
LRR 376 398 2.82e0 SMART
LRR 399 422 9.75e0 SMART
LRR 491 514 2.68e1 SMART
LRR 533 552 1.35e1 SMART
LRR 556 575 5.59e1 SMART
LRR 579 598 2.79e1 SMART
LRR 604 624 1.62e1 SMART
LRR 625 644 1.67e1 SMART
LRR 651 676 1.33e2 SMART
LRR 675 694 1.4e1 SMART
LRR_TYP 699 722 6.78e-3 SMART
LRR 744 768 2.15e2 SMART
PP2Cc 807 1063 2.98e-30 SMART
low complexity region 1096 1130 N/A INTRINSIC
Blast:PP2Cc 1144 1210 8e-15 BLAST
low complexity region 1332 1350 N/A INTRINSIC
Meta Mutation Damage Score 0.254 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.9%
Validation Efficiency 99% (69/70)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal susceptibility to DSS-induced colitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik T A 7: 140,248,961 C178S probably damaging Het
Ano9 A G 7: 141,107,814 I267T probably damaging Het
Anxa6 T A 11: 55,005,828 N168I probably benign Het
Apbb1ip A G 2: 22,819,705 probably benign Het
Aqr G A 2: 114,130,611 H723Y probably damaging Het
Bbx C T 16: 50,280,392 E47K probably benign Het
Car13 A G 3: 14,656,297 probably benign Het
Casp9 T A 4: 141,807,173 I298N possibly damaging Het
Ccdc66 T C 14: 27,498,473 E261G probably damaging Het
Cep192 T A 18: 67,818,883 Y376* probably null Het
Cped1 T A 6: 22,222,546 probably benign Het
Ctbp2 A T 7: 132,999,344 S563R possibly damaging Het
Ctdp1 A G 18: 80,447,422 probably null Het
Dgka G C 10: 128,721,083 probably benign Het
Drd2 A G 9: 49,399,784 T112A probably benign Het
Dusp1 A G 17: 26,508,169 V52A probably damaging Het
Eea1 T A 10: 96,039,772 probably benign Het
Etfrf1 T C 6: 145,215,562 V86A probably benign Het
Fbn1 A T 2: 125,321,676 C2087S possibly damaging Het
Fosb T G 7: 19,307,150 R139S probably damaging Het
Foxm1 C T 6: 128,372,603 R362W probably damaging Het
Frem2 A G 3: 53,653,960 V1042A probably damaging Het
Gbe1 A G 16: 70,483,914 H401R probably benign Het
Gm10549 C T 18: 33,464,182 probably benign Het
Golga7b A T 19: 42,263,319 probably benign Het
H2-DMb1 T C 17: 34,159,425 V235A probably benign Het
Hr A G 14: 70,556,476 T59A probably benign Het
Itpr2 C A 6: 146,359,392 A588S probably benign Het
Kmt2c G A 5: 25,309,708 P3046S probably damaging Het
Lamc1 G A 1: 153,251,065 probably benign Het
Lrp2 A G 2: 69,430,307 Y4527H probably damaging Het
Map3k2 G A 18: 32,212,173 probably null Het
Mroh2a C A 1: 88,242,420 A685D possibly damaging Het
Nfs1 C G 2: 156,132,660 G212R probably damaging Het
Nol8 C T 13: 49,662,447 A677V possibly damaging Het
Nrap T A 19: 56,351,622 Y740F probably damaging Het
Nup205 T A 6: 35,208,837 M859K probably damaging Het
Nxf1 T C 19: 8,767,739 F451S possibly damaging Het
Olfr262 A T 19: 12,241,141 N173K probably damaging Het
Olfr804 G A 10: 129,705,647 M256I probably benign Het
Pcdhac2 T C 18: 37,145,667 Y567H probably damaging Het
Pi4ka A G 16: 17,282,932 probably benign Het
Pmpcb A G 5: 21,748,831 D359G probably damaging Het
Poll T G 19: 45,557,870 S244R probably benign Het
Prkd3 T C 17: 78,957,215 D657G probably null Het
Prune2 G A 19: 17,120,910 M1259I probably benign Het
Ptpra T A 2: 130,537,621 M329K probably damaging Het
Rbm10 GGGAGGAGGAGGAGGAGGAGGATGAGGAGGAGGAGGAGGAG GGGAGGAGGAGGAGGAGGATGAGGAGGAGGAGGAGGAG X: 20,637,559 probably benign Het
Rbm15 G T 3: 107,330,564 D839E probably damaging Het
Sap30bp T A 11: 115,964,277 I271N probably damaging Het
Scn3a A T 2: 65,508,574 V587E probably damaging Het
Setdb1 A T 3: 95,324,853 probably benign Het
Sgk3 T A 1: 9,879,081 probably null Het
Shox2 A T 3: 66,973,851 H265Q probably damaging Het
Slc9a2 T C 1: 40,743,857 F427S possibly damaging Het
Smarca5 T A 8: 80,736,731 Q69H probably benign Het
Specc1l T A 10: 75,248,459 F672Y probably damaging Het
Ssh2 T A 11: 77,408,143 S105R probably damaging Het
Syne2 C T 12: 75,921,226 R917* probably null Het
Tbc1d2 G A 4: 46,649,913 T41M possibly damaging Het
Tbx18 T A 9: 87,724,355 I246F probably damaging Het
Tcf4 T A 18: 69,681,812 probably benign Het
Tmed2 C A 5: 124,541,439 probably null Het
Tmem243 A T 5: 9,101,361 D15V possibly damaging Het
Vmn2r87 T A 10: 130,471,979 S797C probably damaging Het
Vps13c T A 9: 67,886,246 probably benign Het
Wls T A 3: 159,897,437 C162* probably null Het
Zbtb7c C T 18: 76,137,393 T184I probably benign Het
Zc3h13 A G 14: 75,308,965 K169E probably damaging Het
Other mutations in Phlpp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Phlpp2 APN 8 109925790 missense probably benign 0.01
IGL01363:Phlpp2 APN 8 109937097 missense probably benign 0.22
IGL01535:Phlpp2 APN 8 109934065 missense possibly damaging 0.82
IGL01815:Phlpp2 APN 8 109939859 missense probably benign
IGL02105:Phlpp2 APN 8 109904408 missense probably damaging 1.00
IGL02257:Phlpp2 APN 8 109920099 missense possibly damaging 0.88
IGL02318:Phlpp2 APN 8 109939873 missense probably benign 0.04
IGL02500:Phlpp2 APN 8 109913618 missense probably benign
IGL03356:Phlpp2 APN 8 109935617 missense probably benign 0.00
IGL03366:Phlpp2 APN 8 109940835 missense probably benign 0.44
R0142:Phlpp2 UTSW 8 109907513 missense probably damaging 1.00
R0144:Phlpp2 UTSW 8 109907513 missense probably damaging 1.00
R0420:Phlpp2 UTSW 8 109939935 missense probably damaging 0.99
R0426:Phlpp2 UTSW 8 109928463 missense probably benign 0.01
R0477:Phlpp2 UTSW 8 109895506 critical splice acceptor site probably null
R0529:Phlpp2 UTSW 8 109876971 missense probably benign 0.00
R0605:Phlpp2 UTSW 8 109933211 missense probably benign 0.00
R0655:Phlpp2 UTSW 8 109895587 missense probably benign 0.00
R0833:Phlpp2 UTSW 8 109937106 missense probably damaging 1.00
R0836:Phlpp2 UTSW 8 109937106 missense probably damaging 1.00
R1394:Phlpp2 UTSW 8 109877030 nonsense probably null
R1417:Phlpp2 UTSW 8 109940681 nonsense probably null
R1602:Phlpp2 UTSW 8 109934023 missense possibly damaging 0.96
R1650:Phlpp2 UTSW 8 109933955 splice site probably benign
R1815:Phlpp2 UTSW 8 109940223 missense probably damaging 1.00
R2045:Phlpp2 UTSW 8 109907600 missense probably damaging 1.00
R2072:Phlpp2 UTSW 8 109928492 missense possibly damaging 0.88
R2074:Phlpp2 UTSW 8 109928492 missense possibly damaging 0.88
R2075:Phlpp2 UTSW 8 109928492 missense possibly damaging 0.88
R2433:Phlpp2 UTSW 8 109940002 missense probably damaging 1.00
R3028:Phlpp2 UTSW 8 109907613 missense probably damaging 1.00
R4611:Phlpp2 UTSW 8 109876883 missense possibly damaging 0.79
R4718:Phlpp2 UTSW 8 109940820 missense probably benign 0.31
R4739:Phlpp2 UTSW 8 109940420 missense probably damaging 1.00
R4857:Phlpp2 UTSW 8 109877010 missense probably damaging 1.00
R5020:Phlpp2 UTSW 8 109940082 missense probably damaging 1.00
R5047:Phlpp2 UTSW 8 109913619 missense probably benign 0.04
R5074:Phlpp2 UTSW 8 109925829 missense probably damaging 0.99
R5330:Phlpp2 UTSW 8 109934035 missense probably damaging 0.99
R5663:Phlpp2 UTSW 8 109904344 missense probably benign 0.01
R5668:Phlpp2 UTSW 8 109928573 missense possibly damaging 0.67
R6433:Phlpp2 UTSW 8 109934685 missense probably benign
R6470:Phlpp2 UTSW 8 109937194 missense probably benign 0.45
R6804:Phlpp2 UTSW 8 109928565 missense probably damaging 1.00
X0018:Phlpp2 UTSW 8 109912369 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGGTCTGCCAAGATTCAGAAGC -3'
(R):5'- GATGGTCACTTGCTGCTACATCCTC -3'

Sequencing Primer
(F):5'- catgtacccccacatccag -3'
(R):5'- GCTACATCCTCATCTCTATCCAAG -3'
Posted On2013-05-23