Incidental Mutation 'R4996:Atm'
ID385263
Institutional Source Beutler Lab
Gene Symbol Atm
Ensembl Gene ENSMUSG00000034218
Gene Nameataxia telangiectasia mutated
SynonymsC030026E19Rik
MMRRC Submission 042590-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.816) question?
Stock #R4996 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location53439149-53536740 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 53524507 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 168 (F168I)
Ref Sequence ENSEMBL: ENSMUSP00000156344 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118282] [ENSMUST00000150244] [ENSMUST00000232179]
Predicted Effect probably benign
Transcript: ENSMUST00000118282
AA Change: F168I

PolyPhen 2 Score 0.095 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000113388
Gene: ENSMUSG00000034218
AA Change: F168I

DomainStartEndE-ValueType
TAN 1 166 5.07e-68 SMART
low complexity region 431 445 N/A INTRINSIC
low complexity region 830 846 N/A INTRINSIC
low complexity region 929 940 N/A INTRINSIC
SCOP:d1gw5a_ 1039 1568 2e-4 SMART
coiled coil region 1615 1644 N/A INTRINSIC
low complexity region 1650 1662 N/A INTRINSIC
Pfam:FAT 2102 2499 4.4e-50 PFAM
low complexity region 2587 2599 N/A INTRINSIC
PI3Kc 2723 3026 1.11e-117 SMART
FATC 3034 3066 3.71e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132403
Predicted Effect probably benign
Transcript: ENSMUST00000150244
SMART Domains Protein: ENSMUSP00000115394
Gene: ENSMUSG00000034218

DomainStartEndE-ValueType
TAN 1 140 2.88e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000232179
AA Change: F168I

PolyPhen 2 Score 0.095 (Sensitivity: 0.93; Specificity: 0.85)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the PI3/PI4-kinase family. This protein is an important cell cycle checkpoint kinase that phosphorylates; thus, it functions as a regulator of a wide variety of downstream proteins, including tumor suppressor proteins p53 and BRCA1, checkpoint kinase CHK2, checkpoint proteins RAD17 and RAD9, and DNA repair protein NBS1. This protein and the closely related kinase ATR are thought to be master controllers of cell cycle checkpoint signaling pathways that are required for cell response to DNA damage and for genome stability. Mutations in this gene are associated with ataxia telangiectasia, an autosomal recessive disorder. [provided by RefSeq, Aug 2010]
PHENOTYPE: Homozygotes for null mutations may exhibit locomotor abnormalities, motor learning deficits, growth retardation, sterility due to meiotic arrest, and susceptibility to thymic lymphomas. Mice homozygous for a kinase dead allele exhibit early embryonic lethality associated with genetic instability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
Actl11 A G 9: 107,931,735 I1086V possibly damaging Het
Adgrv1 T C 13: 81,578,734 S500G probably benign Het
Ahcyl1 A T 3: 107,668,287 V394E probably damaging Het
Alg9 T C 9: 50,808,705 F494L probably damaging Het
Ankrd55 C A 13: 112,356,088 D264E possibly damaging Het
Asb14 A G 14: 26,912,116 N426S possibly damaging Het
Atp13a4 A T 16: 29,472,004 I209N probably damaging Het
BB014433 A T 8: 15,042,166 L229Q probably benign Het
C130026I21Rik G T 1: 85,247,094 A240E probably benign Het
Calml3 T C 13: 3,804,142 D21G probably damaging Het
Capn10 A G 1: 92,945,136 N528S probably damaging Het
Ccnl2 T A 4: 155,813,524 D141E possibly damaging Het
Cd163 A G 6: 124,319,147 I817V probably benign Het
Cgnl1 CTTGCCCAGGTT CTT 9: 71,724,826 probably benign Het
Cln6 T A 9: 62,850,655 I232N probably damaging Het
Col22a1 A C 15: 72,007,161 V49G probably damaging Het
Csmd1 A T 8: 15,910,452 M3321K probably damaging Het
Cyp2u1 T A 3: 131,298,284 M196L probably benign Het
Dlec1 T G 9: 119,146,050 L1566R probably damaging Het
Dnajc3 A G 14: 118,972,427 T305A probably benign Het
Drp2 G A X: 134,441,316 R567H probably damaging Homo
Efhd1 G T 1: 87,264,558 G37W possibly damaging Het
Exph5 G C 9: 53,375,610 E1330D possibly damaging Het
Fam207a A T 10: 77,515,533 W14R probably null Het
Fbln2 A T 6: 91,266,010 Y913F probably benign Het
Fmnl1 G A 11: 103,182,656 S167N possibly damaging Het
Frs3 A G 17: 47,701,710 E114G probably damaging Het
Gm960 T A 19: 4,626,084 K673N probably benign Het
Gmpr2 T C 14: 55,676,795 I169T probably damaging Het
Gria2 A G 3: 80,707,141 S531P probably damaging Het
Hace1 G A 10: 45,649,950 A296T probably benign Het
Hrasls G A 16: 29,217,704 W31* probably null Het
Inhbb A C 1: 119,420,818 L90R probably damaging Het
Insr C T 8: 3,192,665 R18Q probably null Het
Kdm6b G T 11: 69,405,731 P570Q probably damaging Het
Lama3 T C 18: 12,518,743 V1803A probably benign Het
Lpin3 T A 2: 160,905,287 L811Q probably damaging Het
Lrrc8e C T 8: 4,235,166 L464F probably damaging Het
Micall2 A G 5: 139,710,589 S729P probably benign Het
Naca C T 10: 128,042,429 probably benign Het
Nav1 A T 1: 135,465,971 S1010T probably damaging Het
Nefm T C 14: 68,121,121 probably benign Het
Nlrp9c A T 7: 26,385,747 F136I possibly damaging Het
Nup210 A T 6: 91,053,436 F137Y probably benign Het
Olfr1079 T C 2: 86,538,271 I215V probably benign Het
Olfr402 A G 11: 74,155,331 H59R probably damaging Het
Olfr98 A G 17: 37,262,867 S266P probably benign Het
Otog C A 7: 46,298,606 H2344N possibly damaging Het
Otog C A 7: 46,305,510 C517* probably null Het
Pcdhac1 C T 18: 37,092,527 Q798* probably null Het
Pdhx T C 2: 103,030,312 D330G probably damaging Het
Peg10 ACATCAGGATCC ACATCAGGATCCCCATCAGGATCC 6: 4,756,454 probably benign Het
Pgr C A 9: 8,900,913 P149Q probably damaging Het
Ppm1h A T 10: 122,941,340 I504F probably damaging Het
Ppp6r3 A G 19: 3,473,833 S556P probably damaging Het
Ranbp9 G A 13: 43,425,094 Q168* probably null Het
Relb A T 7: 19,615,603 L259Q probably benign Het
Rfx5 G A 3: 94,955,815 V73I probably benign Het
Rgcc T C 14: 79,290,276 D125G possibly damaging Het
Rmnd5b A G 11: 51,627,908 V86A probably damaging Het
Slc15a5 G A 6: 138,043,585 T250M probably damaging Het
Slc7a2 A T 8: 40,912,562 K477* probably null Het
Smc2 T A 4: 52,461,042 probably null Het
Sox5 A T 6: 144,028,344 L226* probably null Het
Syne2 A G 12: 75,943,950 E1903G possibly damaging Het
Tenm3 A T 8: 48,235,826 I2226N probably damaging Het
Tmtc3 A T 10: 100,447,224 I823N probably damaging Het
Tor3a T C 1: 156,655,772 Y360C probably damaging Het
Trpc3 T C 3: 36,662,818 E357G probably benign Het
Ttc30a1 C T 2: 75,979,922 G606S probably benign Het
Tubgcp6 A T 15: 89,103,490 N1093K possibly damaging Het
Vmn1r64 T A 7: 5,884,053 T164S probably benign Het
Vmn2r40 T A 7: 8,908,167 Q709L probably damaging Het
Vmn2r81 A T 10: 79,293,413 I713L probably benign Het
Washc5 T C 15: 59,333,635 T686A probably benign Het
Wipf1 GCCTCCTCCTCCTCCTCCTCCTCC GCCTCCTCCTCCTCCTCCTCC 2: 73,440,074 probably benign Het
Other mutations in Atm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Atm APN 9 53524443 missense probably damaging 1.00
IGL00466:Atm APN 9 53499112 splice site probably benign
IGL00567:Atm APN 9 53503116 nonsense probably null
IGL00702:Atm APN 9 53511831 missense probably benign 0.02
IGL00743:Atm APN 9 53513116 missense probably benign 0.00
IGL00771:Atm APN 9 53493054 missense probably benign 0.01
IGL00773:Atm APN 9 53522144 missense probably benign 0.00
IGL00819:Atm APN 9 53518531 missense probably damaging 1.00
IGL00864:Atm APN 9 53533933 missense probably damaging 0.99
IGL00985:Atm APN 9 53459816 missense probably damaging 0.98
IGL01109:Atm APN 9 53490293 missense probably damaging 1.00
IGL01120:Atm APN 9 53461122 critical splice acceptor site probably null
IGL01369:Atm APN 9 53515317 missense probably benign
IGL01374:Atm APN 9 53531724 missense possibly damaging 0.58
IGL01406:Atm APN 9 53439746 makesense probably null
IGL01409:Atm APN 9 53499171 missense probably benign 0.01
IGL01434:Atm APN 9 53507807 missense probably benign 0.04
IGL01486:Atm APN 9 53510213 missense probably benign
IGL01583:Atm APN 9 53484247 splice site probably benign
IGL01861:Atm APN 9 53494612 missense probably null 0.89
IGL01865:Atm APN 9 53461002 missense probably damaging 1.00
IGL02026:Atm APN 9 53442417 unclassified probably null
IGL02072:Atm APN 9 53459796 missense probably benign 0.01
IGL02075:Atm APN 9 53527237 missense probably damaging 1.00
IGL02127:Atm APN 9 53487983 missense probably damaging 1.00
IGL02175:Atm APN 9 53480665 missense probably damaging 0.99
IGL02246:Atm APN 9 53527185 missense probably benign 0.12
IGL02259:Atm APN 9 53518494 splice site probably benign
IGL02351:Atm APN 9 53522176 missense probably benign 0.04
IGL02358:Atm APN 9 53522176 missense probably benign 0.04
IGL02387:Atm APN 9 53479766 splice site probably null
IGL02417:Atm APN 9 53479695 missense probably benign 0.00
IGL02422:Atm APN 9 53500792 missense probably damaging 1.00
IGL02445:Atm APN 9 53454330 missense probably benign 0.00
IGL02492:Atm APN 9 53455859 missense probably damaging 0.99
IGL02513:Atm APN 9 53497262 splice site probably benign
IGL02633:Atm APN 9 53448153 missense probably damaging 1.00
IGL02634:Atm APN 9 53516563 missense probably benign 0.00
IGL02948:Atm APN 9 53453440 splice site probably benign
IGL02959:Atm APN 9 53471418 missense probably damaging 1.00
IGL02965:Atm APN 9 53453563 missense probably damaging 1.00
IGL03085:Atm APN 9 53484171 missense possibly damaging 0.89
antebellum UTSW 9 53518559 nonsense probably null
civil UTSW 9 53492268 missense possibly damaging 0.78
mockingbird UTSW 9 53516467 nonsense probably null
mockingbird2 UTSW 9 53488587 missense probably damaging 1.00
osphere UTSW 9 53479673 missense probably damaging 0.99
Strato UTSW 9 53503018 missense probably damaging 1.00
tropo UTSW 9 53531648 missense probably damaging 1.00
P0019:Atm UTSW 9 53465028 splice site probably benign
PIT4403001:Atm UTSW 9 53500982 missense probably benign
PIT4687001:Atm UTSW 9 53486812 critical splice donor site probably null
R0004:Atm UTSW 9 53453528 splice site probably benign
R0035:Atm UTSW 9 53513180 missense probably benign 0.01
R0098:Atm UTSW 9 53518569 missense probably benign 0.10
R0098:Atm UTSW 9 53518569 missense probably benign 0.10
R0201:Atm UTSW 9 53454279 splice site probably benign
R0304:Atm UTSW 9 53516344 missense probably benign 0.34
R0308:Atm UTSW 9 53454473 intron probably null
R0362:Atm UTSW 9 53458838 missense possibly damaging 0.90
R0470:Atm UTSW 9 53460966 missense probably damaging 1.00
R0513:Atm UTSW 9 53503948 missense probably benign 0.00
R0589:Atm UTSW 9 53490192 missense possibly damaging 0.51
R0617:Atm UTSW 9 53458941 nonsense probably null
R0630:Atm UTSW 9 53531622 splice site probably benign
R0652:Atm UTSW 9 53486014 missense probably damaging 0.98
R0698:Atm UTSW 9 53515239 missense probably damaging 1.00
R0737:Atm UTSW 9 53456566 missense probably damaging 1.00
R0885:Atm UTSW 9 53459823 missense probably benign
R0947:Atm UTSW 9 53504092 missense probably benign 0.01
R0948:Atm UTSW 9 53495958 missense probably benign
R1144:Atm UTSW 9 53511698 splice site probably benign
R1252:Atm UTSW 9 53455840 missense probably damaging 1.00
R1295:Atm UTSW 9 53456530 missense probably damaging 1.00
R1296:Atm UTSW 9 53456530 missense probably damaging 1.00
R1419:Atm UTSW 9 53457489 missense probably benign 0.00
R1477:Atm UTSW 9 53464273 missense probably benign 0.00
R1596:Atm UTSW 9 53453378 missense probably damaging 1.00
R1630:Atm UTSW 9 53479673 missense probably damaging 0.99
R1667:Atm UTSW 9 53500932 missense probably damaging 1.00
R1681:Atm UTSW 9 53522155 missense possibly damaging 0.94
R1703:Atm UTSW 9 53500700 missense probably benign
R1817:Atm UTSW 9 53492233 splice site probably benign
R1840:Atm UTSW 9 53456530 missense probably damaging 1.00
R1848:Atm UTSW 9 53468012 missense probably benign 0.06
R1906:Atm UTSW 9 53506568 missense probably damaging 1.00
R1958:Atm UTSW 9 53471418 missense probably damaging 1.00
R2108:Atm UTSW 9 53443997 missense probably damaging 1.00
R2116:Atm UTSW 9 53500969 missense probably benign 0.36
R2134:Atm UTSW 9 53467964 critical splice donor site probably null
R2137:Atm UTSW 9 53453375 missense probably damaging 1.00
R2291:Atm UTSW 9 53490909 splice site probably null
R2348:Atm UTSW 9 53492268 missense possibly damaging 0.78
R2483:Atm UTSW 9 53510266 missense probably damaging 1.00
R2567:Atm UTSW 9 53457470 missense possibly damaging 0.72
R2897:Atm UTSW 9 53507805 missense probably damaging 0.99
R2939:Atm UTSW 9 53494711 missense probably damaging 1.00
R3008:Atm UTSW 9 53480750 missense probably benign 0.00
R3236:Atm UTSW 9 53479748 missense probably benign 0.15
R3847:Atm UTSW 9 53503075 missense possibly damaging 0.94
R3889:Atm UTSW 9 53506636 splice site probably benign
R3919:Atm UTSW 9 53492278 missense probably benign 0.00
R4125:Atm UTSW 9 53450621 missense probably damaging 1.00
R4222:Atm UTSW 9 53480669 missense probably benign
R4395:Atm UTSW 9 53465227 missense probably benign 0.09
R4466:Atm UTSW 9 53448169 nonsense probably null
R4502:Atm UTSW 9 53495946 missense possibly damaging 0.92
R4514:Atm UTSW 9 53493039 missense probably damaging 0.99
R4528:Atm UTSW 9 53500759 missense probably benign 0.39
R4593:Atm UTSW 9 53453594 missense possibly damaging 0.55
R4627:Atm UTSW 9 53456506 missense possibly damaging 0.79
R4634:Atm UTSW 9 53531733 missense probably benign 0.01
R4665:Atm UTSW 9 53464229 missense probably benign 0.00
R4672:Atm UTSW 9 53522201 missense probably damaging 0.99
R4741:Atm UTSW 9 53453607 missense probably benign 0.10
R4808:Atm UTSW 9 53445495 missense probably damaging 0.99
R4959:Atm UTSW 9 53515301 missense probably benign
R5030:Atm UTSW 9 53520109 nonsense probably null
R5214:Atm UTSW 9 53491027 missense probably benign 0.09
R5260:Atm UTSW 9 53506611 missense probably damaging 0.99
R5311:Atm UTSW 9 53518623 missense probably benign 0.00
R5394:Atm UTSW 9 53507777 critical splice donor site probably null
R5400:Atm UTSW 9 53503018 missense probably damaging 1.00
R5436:Atm UTSW 9 53459804 missense probably benign 0.00
R5441:Atm UTSW 9 53516467 nonsense probably null
R5569:Atm UTSW 9 53516450 nonsense probably null
R5856:Atm UTSW 9 53495955 missense possibly damaging 0.64
R5891:Atm UTSW 9 53497159 missense probably benign
R5910:Atm UTSW 9 53448080 missense probably damaging 0.96
R6054:Atm UTSW 9 53459873 missense probably damaging 1.00
R6062:Atm UTSW 9 53488587 missense probably damaging 1.00
R6092:Atm UTSW 9 53524414 missense probably damaging 1.00
R6127:Atm UTSW 9 53524509 missense probably damaging 1.00
R6160:Atm UTSW 9 53490959 missense probably benign 0.04
R6267:Atm UTSW 9 53444000 missense probably damaging 1.00
R6273:Atm UTSW 9 53487922 missense probably benign 0.09
R6284:Atm UTSW 9 53445376 splice site probably null
R6478:Atm UTSW 9 53490254 missense probably damaging 1.00
R6547:Atm UTSW 9 53440157 missense probably damaging 1.00
R6549:Atm UTSW 9 53493177 missense probably benign 0.00
R6704:Atm UTSW 9 53458853 missense probably benign 0.02
R6715:Atm UTSW 9 53531648 missense probably damaging 1.00
R6737:Atm UTSW 9 53486051 missense probably benign 0.30
R6759:Atm UTSW 9 53518559 nonsense probably null
R6766:Atm UTSW 9 53490282 missense probably damaging 0.99
R6813:Atm UTSW 9 53497235 missense probably benign 0.00
R6852:Atm UTSW 9 53482430 missense possibly damaging 0.93
R7064:Atm UTSW 9 53507881 missense probably benign 0.02
X0067:Atm UTSW 9 53479694 missense probably benign 0.00
Z1088:Atm UTSW 9 53531687 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGGTCTAATTACCTGGCATACTG -3'
(R):5'- GGACACCAAAACTTAGTGACTTTG -3'

Sequencing Primer
(F):5'- ACCTGGCATACTGAATAGCCTTGG -3'
(R):5'- ACTTTGTTAGTCCTAGCTAAAACAGC -3'
Posted On2016-05-10