Incidental Mutation 'R4997:Pik3c2b'
ID385307
Institutional Source Beutler Lab
Gene Symbol Pik3c2b
Ensembl Gene ENSMUSG00000026447
Gene Namephosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 beta
SynonymsC330011J12Rik, PI3K-C2beta
MMRRC Submission 042591-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.265) question?
Stock #R4997 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location133045667-133108687 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 133105081 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 1560 (A1560V)
Ref Sequence ENSEMBL: ENSMUSP00000076911 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077730]
Predicted Effect probably damaging
Transcript: ENSMUST00000077730
AA Change: A1560V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076911
Gene: ENSMUSG00000026447
AA Change: A1560V

DomainStartEndE-ValueType
low complexity region 155 160 N/A INTRINSIC
low complexity region 168 183 N/A INTRINSIC
PI3K_rbd 363 465 2.15e-19 SMART
PI3K_C2 618 726 6.17e-29 SMART
PI3Ka 804 990 1.66e-84 SMART
PI3Kc 1078 1340 3.45e-132 SMART
PX 1364 1476 9.44e-27 SMART
low complexity region 1481 1492 N/A INTRINSIC
C2 1517 1622 1.82e-18 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. The PI3-kinase activity of this protein is sensitive to low nanomolar levels of the inhibitor wortmanin. The C2 domain of this protein was shown to bind phospholipids but not Ca2+, which suggests that this enzyme may function in a calcium-independent manner. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal epidermal growth, differentiation and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T G 7: 28,143,924 S746A possibly damaging Het
A630023A22Rik A T 14: 34,053,666 M1L probably benign Het
Abca7 C A 10: 80,007,320 Q1210K possibly damaging Het
Abcc4 C T 14: 118,516,503 W1024* probably null Het
Accs A T 2: 93,841,883 Y213* probably null Het
Adam6a G T 12: 113,545,371 G455C probably damaging Het
Adcy1 A C 11: 7,161,298 Y863S probably benign Het
Adgrg1 A G 8: 95,009,520 D434G probably damaging Het
Afap1l1 C T 18: 61,751,808 R202Q probably benign Het
Aldh3a1 T C 11: 61,212,311 V27A probably benign Het
Antxr2 A G 5: 97,977,694 F235L probably benign Het
Arhgap23 T A 11: 97,452,020 V376E probably damaging Het
Brca1 A C 11: 101,524,333 S992A probably damaging Het
Calcrl A T 2: 84,351,248 C185* probably null Het
Cep152 T C 2: 125,586,351 T787A probably benign Het
Coch T A 12: 51,603,181 probably null Het
Col5a1 T A 2: 28,032,782 Y287* probably null Het
Dis3l A G 9: 64,311,942 S569P possibly damaging Het
Dnaic1 A G 4: 41,597,919 I74V possibly damaging Het
Dpy19l4 A G 4: 11,287,493 V394A probably benign Het
Egfem1 A G 3: 29,153,590 H122R probably benign Het
Endou A G 15: 97,719,577 L164P probably damaging Het
Epgn A G 5: 91,032,239 E80G possibly damaging Het
Fitm1 T C 14: 55,576,907 S287P probably benign Het
Foxm1 A G 6: 128,365,768 N22D probably benign Het
Gm5136 A G 10: 108,699,788 I102T probably benign Het
Gsdmc A T 15: 63,776,780 M426K probably damaging Het
Hmcn2 T A 2: 31,401,708 V2418D probably damaging Het
Hs3st2 T A 7: 121,500,456 L175Q possibly damaging Het
Il1r2 T C 1: 40,121,046 probably null Het
Il27ra A T 8: 84,039,527 Y209* probably null Het
Inpp5a A T 7: 139,400,738 S31C probably benign Het
Invs A G 4: 48,396,332 D335G probably damaging Het
Isg15 C T 4: 156,199,697 E125K possibly damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lama4 C A 10: 39,092,266 T1468K probably damaging Het
Lce1a2 A G 3: 92,669,088 S56P unknown Het
Llgl1 C T 11: 60,709,568 P581L probably benign Het
Lmf1 G A 17: 25,588,676 W164* probably null Het
Mad2l1bp G T 17: 46,152,878 C73* probably null Het
Mpzl1 A C 1: 165,601,781 V230G probably damaging Het
Myo3b A G 2: 70,258,083 T869A possibly damaging Het
Ncor2 T C 5: 125,034,010 H1316R probably damaging Het
Nlrp1b T A 11: 71,218,334 I114F probably damaging Het
Nsun7 A G 5: 66,295,839 I632M probably benign Het
Nubp1 T C 16: 10,421,321 I234T probably benign Het
Olfml1 A G 7: 107,571,206 D100G probably damaging Het
Olfr22-ps1 T A 11: 73,954,786 L32Q probably damaging Het
Olfr498 C A 7: 108,465,494 Q57K probably benign Het
Olfr839-ps1 A T 9: 19,175,331 L115Q probably damaging Het
Osmr G T 15: 6,815,639 P882Q probably benign Het
Peg10 TCAGGATCC TCAGGATCCCCAGCAGGATCC 6: 4,756,457 probably benign Het
Per2 T A 1: 91,450,783 T15S probably benign Het
Piezo2 A G 18: 63,083,113 Y1184H probably damaging Het
Pik3cd A C 4: 149,658,984 L256R probably damaging Het
Ppl C A 16: 5,089,371 R1020L probably damaging Het
Ppp1r10 A G 17: 35,924,084 N60S probably damaging Het
Prkcg T C 7: 3,322,581 probably null Het
Prkci T C 3: 31,031,226 probably null Het
Prrc2b A G 2: 32,222,311 Y1929C probably damaging Het
Prss12 T C 3: 123,447,208 V17A probably benign Het
Qtrt1 A G 9: 21,417,358 N206S probably benign Het
Rad54l2 A C 9: 106,722,909 S50A possibly damaging Het
Rhov C T 2: 119,270,468 R96H probably damaging Het
Rph3a A T 5: 120,963,843 V110E probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Ryr2 A T 13: 11,595,306 N646K probably benign Het
Scn8a A G 15: 100,957,054 T141A probably damaging Het
Serping1 T C 2: 84,770,285 R238G possibly damaging Het
Shank3 T A 15: 89,549,698 W1474R probably damaging Het
Slc16a12 T A 19: 34,674,958 M263L probably benign Het
Spata13 T C 14: 60,709,459 V652A probably damaging Het
Spata31 G A 13: 64,919,723 M66I probably benign Het
Spem2 T C 11: 69,817,732 I136V probably benign Het
Supt5 T C 7: 28,316,037 H925R probably benign Het
Syk A T 13: 52,612,448 K190* probably null Het
Thsd1 T A 8: 22,243,324 V129D probably damaging Het
Tiprl A G 1: 165,220,190 V174A possibly damaging Het
Tmed4 T A 11: 6,274,500 probably null Het
Tnfrsf19 T C 14: 60,971,209 T288A probably benign Het
Tnfrsf25 T C 4: 152,117,696 probably null Het
Tpd52 A G 3: 8,934,996 L121S probably damaging Het
Trim30a T A 7: 104,411,620 K316N probably benign Het
Ttc3 T G 16: 94,452,982 D1221E probably damaging Het
Ttn C T 2: 76,884,059 probably benign Het
Ttn T C 2: 76,946,271 I1514V probably benign Het
Ulk2 T C 11: 61,799,156 T671A probably benign Het
Wasf1 C T 10: 40,934,604 P281S probably damaging Het
Wnt10b C A 15: 98,774,203 R211L probably damaging Het
Xpnpep3 T A 15: 81,448,376 C371* probably null Het
Zfp41 C T 15: 75,618,768 probably benign Het
Zfp553 T A 7: 127,235,511 N79K probably benign Het
Zmynd8 G T 2: 165,792,816 D1096E probably benign Het
Other mutations in Pik3c2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01086:Pik3c2b APN 1 133091618 missense probably damaging 0.98
IGL01288:Pik3c2b APN 1 133094805 missense probably damaging 0.96
IGL01313:Pik3c2b APN 1 133071631 nonsense probably null
IGL01367:Pik3c2b APN 1 133105988 missense probably benign 0.02
IGL02379:Pik3c2b APN 1 133094791 missense probably damaging 1.00
IGL02638:Pik3c2b APN 1 133077318 splice site probably benign
IGL02728:Pik3c2b APN 1 133092327 missense probably benign 0.09
IGL02992:Pik3c2b APN 1 133066980 nonsense probably null
IGL03121:Pik3c2b APN 1 133079745 missense probably benign 0.00
R0453:Pik3c2b UTSW 1 133077396 missense probably damaging 1.00
R0518:Pik3c2b UTSW 1 133105992 missense probably damaging 1.00
R0616:Pik3c2b UTSW 1 133100831 missense probably damaging 1.00
R0659:Pik3c2b UTSW 1 133071200 missense probably damaging 0.99
R1542:Pik3c2b UTSW 1 133090034 missense probably damaging 1.00
R1716:Pik3c2b UTSW 1 133094826 missense probably damaging 1.00
R1728:Pik3c2b UTSW 1 133066627 missense probably benign 0.00
R1729:Pik3c2b UTSW 1 133066627 missense probably benign 0.00
R1730:Pik3c2b UTSW 1 133066627 missense probably benign 0.00
R1739:Pik3c2b UTSW 1 133066627 missense probably benign 0.00
R1762:Pik3c2b UTSW 1 133066627 missense probably benign 0.00
R1783:Pik3c2b UTSW 1 133066627 missense probably benign 0.00
R1784:Pik3c2b UTSW 1 133066627 missense probably benign 0.00
R1785:Pik3c2b UTSW 1 133066627 missense probably benign 0.00
R1816:Pik3c2b UTSW 1 133101370 missense probably benign 0.00
R1897:Pik3c2b UTSW 1 133066916 missense possibly damaging 0.57
R2006:Pik3c2b UTSW 1 133066544 missense probably damaging 1.00
R2067:Pik3c2b UTSW 1 133099611 missense probably damaging 1.00
R2271:Pik3c2b UTSW 1 133103428 missense probably benign
R2294:Pik3c2b UTSW 1 133066775 missense probably damaging 1.00
R2320:Pik3c2b UTSW 1 133103413 missense probably damaging 1.00
R4735:Pik3c2b UTSW 1 133067049 missense probably benign 0.25
R4926:Pik3c2b UTSW 1 133099626 nonsense probably null
R4948:Pik3c2b UTSW 1 133099715 critical splice donor site probably null
R5304:Pik3c2b UTSW 1 133070408 missense possibly damaging 0.50
R5461:Pik3c2b UTSW 1 133099702 missense possibly damaging 0.66
R5722:Pik3c2b UTSW 1 133103836 missense probably damaging 1.00
R5971:Pik3c2b UTSW 1 133074627 splice site probably null
R5980:Pik3c2b UTSW 1 133088308 missense probably benign 0.43
R6036:Pik3c2b UTSW 1 133090713 missense possibly damaging 0.95
R6138:Pik3c2b UTSW 1 133074627 splice site probably null
R6223:Pik3c2b UTSW 1 133070357 missense probably damaging 1.00
R6273:Pik3c2b UTSW 1 133066711 missense probably benign 0.02
R6742:Pik3c2b UTSW 1 133075821 missense probably benign
R6954:Pik3c2b UTSW 1 133066303 missense possibly damaging 0.50
R6998:Pik3c2b UTSW 1 133102372 missense probably benign 0.23
R7103:Pik3c2b UTSW 1 133105974 missense probably damaging 1.00
R7133:Pik3c2b UTSW 1 133090234 missense possibly damaging 0.73
R7161:Pik3c2b UTSW 1 133106112 missense probably damaging 0.98
R7183:Pik3c2b UTSW 1 133066465 missense probably benign 0.00
R7193:Pik3c2b UTSW 1 133079774 missense probably benign 0.00
R7252:Pik3c2b UTSW 1 133094734 missense probably benign 0.19
R7263:Pik3c2b UTSW 1 133090202 missense probably damaging 0.98
R7404:Pik3c2b UTSW 1 133090706 missense probably damaging 1.00
U15987:Pik3c2b UTSW 1 133074627 splice site probably null
X0060:Pik3c2b UTSW 1 133084936 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- TTAGGTGCATGCCACAAAACG -3'
(R):5'- GCAATGAGCAAGTGTGACTAAC -3'

Sequencing Primer
(F):5'- AGATATAATCTAGACCAAAGGGTAGC -3'
(R):5'- CTTATAAGAAGGGACGGCTGGTTG -3'
Posted On2016-05-10