Incidental Mutation 'R4997:Serping1'
ID385317
Institutional Source Beutler Lab
Gene Symbol Serping1
Ensembl Gene ENSMUSG00000023224
Gene Nameserine (or cysteine) peptidase inhibitor, clade G, member 1
SynonymsC1INH, C1 inhibitor, C1nh
MMRRC Submission 042591-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.281) question?
Stock #R4997 (G1)
Quality Score190
Status Not validated
Chromosome2
Chromosomal Location84765387-84775444 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 84770285 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 238 (R238G)
Ref Sequence ENSEMBL: ENSMUSP00000107268 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023994] [ENSMUST00000111641]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023994
AA Change: R238G

PolyPhen 2 Score 0.584 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000023994
Gene: ENSMUSG00000023224
AA Change: R238G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
SERPIN 156 502 3.26e-97 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000111641
AA Change: R238G

PolyPhen 2 Score 0.740 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000107268
Gene: ENSMUSG00000023224
AA Change: R238G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
SERPIN 156 347 5.39e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131456
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a highly glycosylated plasma protein involved in the regulation of the complement cascade. Its protein inhibits activated C1r and C1s of the first complement component and thus regulates complement activation. Deficiency of this protein is associated with hereditary angioneurotic oedema (HANE). Alternative splicing results in multiple transcript variants encoding the same isoform. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutant mice exhibit an increased vascular permeability compared to controls. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T G 7: 28,143,924 S746A possibly damaging Het
A630023A22Rik A T 14: 34,053,666 M1L probably benign Het
Abca7 C A 10: 80,007,320 Q1210K possibly damaging Het
Abcc4 C T 14: 118,516,503 W1024* probably null Het
Accs A T 2: 93,841,883 Y213* probably null Het
Adam6a G T 12: 113,545,371 G455C probably damaging Het
Adcy1 A C 11: 7,161,298 Y863S probably benign Het
Adgrg1 A G 8: 95,009,520 D434G probably damaging Het
Afap1l1 C T 18: 61,751,808 R202Q probably benign Het
Aldh3a1 T C 11: 61,212,311 V27A probably benign Het
Antxr2 A G 5: 97,977,694 F235L probably benign Het
Arhgap23 T A 11: 97,452,020 V376E probably damaging Het
Brca1 A C 11: 101,524,333 S992A probably damaging Het
Calcrl A T 2: 84,351,248 C185* probably null Het
Cep152 T C 2: 125,586,351 T787A probably benign Het
Coch T A 12: 51,603,181 probably null Het
Col5a1 T A 2: 28,032,782 Y287* probably null Het
Dis3l A G 9: 64,311,942 S569P possibly damaging Het
Dnaic1 A G 4: 41,597,919 I74V possibly damaging Het
Dpy19l4 A G 4: 11,287,493 V394A probably benign Het
Egfem1 A G 3: 29,153,590 H122R probably benign Het
Endou A G 15: 97,719,577 L164P probably damaging Het
Epgn A G 5: 91,032,239 E80G possibly damaging Het
Fitm1 T C 14: 55,576,907 S287P probably benign Het
Foxm1 A G 6: 128,365,768 N22D probably benign Het
Gm5136 A G 10: 108,699,788 I102T probably benign Het
Gsdmc A T 15: 63,776,780 M426K probably damaging Het
Hmcn2 T A 2: 31,401,708 V2418D probably damaging Het
Hs3st2 T A 7: 121,500,456 L175Q possibly damaging Het
Il1r2 T C 1: 40,121,046 probably null Het
Il27ra A T 8: 84,039,527 Y209* probably null Het
Inpp5a A T 7: 139,400,738 S31C probably benign Het
Invs A G 4: 48,396,332 D335G probably damaging Het
Isg15 C T 4: 156,199,697 E125K possibly damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lama4 C A 10: 39,092,266 T1468K probably damaging Het
Lce1a2 A G 3: 92,669,088 S56P unknown Het
Llgl1 C T 11: 60,709,568 P581L probably benign Het
Lmf1 G A 17: 25,588,676 W164* probably null Het
Mad2l1bp G T 17: 46,152,878 C73* probably null Het
Mpzl1 A C 1: 165,601,781 V230G probably damaging Het
Myo3b A G 2: 70,258,083 T869A possibly damaging Het
Ncor2 T C 5: 125,034,010 H1316R probably damaging Het
Nlrp1b T A 11: 71,218,334 I114F probably damaging Het
Nsun7 A G 5: 66,295,839 I632M probably benign Het
Nubp1 T C 16: 10,421,321 I234T probably benign Het
Olfml1 A G 7: 107,571,206 D100G probably damaging Het
Olfr22-ps1 T A 11: 73,954,786 L32Q probably damaging Het
Olfr498 C A 7: 108,465,494 Q57K probably benign Het
Olfr839-ps1 A T 9: 19,175,331 L115Q probably damaging Het
Osmr G T 15: 6,815,639 P882Q probably benign Het
Peg10 TCAGGATCC TCAGGATCCCCAGCAGGATCC 6: 4,756,457 probably benign Het
Per2 T A 1: 91,450,783 T15S probably benign Het
Piezo2 A G 18: 63,083,113 Y1184H probably damaging Het
Pik3c2b C T 1: 133,105,081 A1560V probably damaging Het
Pik3cd A C 4: 149,658,984 L256R probably damaging Het
Ppl C A 16: 5,089,371 R1020L probably damaging Het
Ppp1r10 A G 17: 35,924,084 N60S probably damaging Het
Prkcg T C 7: 3,322,581 probably null Het
Prkci T C 3: 31,031,226 probably null Het
Prrc2b A G 2: 32,222,311 Y1929C probably damaging Het
Prss12 T C 3: 123,447,208 V17A probably benign Het
Qtrt1 A G 9: 21,417,358 N206S probably benign Het
Rad54l2 A C 9: 106,722,909 S50A possibly damaging Het
Rhov C T 2: 119,270,468 R96H probably damaging Het
Rph3a A T 5: 120,963,843 V110E probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Ryr2 A T 13: 11,595,306 N646K probably benign Het
Scn8a A G 15: 100,957,054 T141A probably damaging Het
Shank3 T A 15: 89,549,698 W1474R probably damaging Het
Slc16a12 T A 19: 34,674,958 M263L probably benign Het
Spata13 T C 14: 60,709,459 V652A probably damaging Het
Spata31 G A 13: 64,919,723 M66I probably benign Het
Spem2 T C 11: 69,817,732 I136V probably benign Het
Supt5 T C 7: 28,316,037 H925R probably benign Het
Syk A T 13: 52,612,448 K190* probably null Het
Thsd1 T A 8: 22,243,324 V129D probably damaging Het
Tiprl A G 1: 165,220,190 V174A possibly damaging Het
Tmed4 T A 11: 6,274,500 probably null Het
Tnfrsf19 T C 14: 60,971,209 T288A probably benign Het
Tnfrsf25 T C 4: 152,117,696 probably null Het
Tpd52 A G 3: 8,934,996 L121S probably damaging Het
Trim30a T A 7: 104,411,620 K316N probably benign Het
Ttc3 T G 16: 94,452,982 D1221E probably damaging Het
Ttn C T 2: 76,884,059 probably benign Het
Ttn T C 2: 76,946,271 I1514V probably benign Het
Ulk2 T C 11: 61,799,156 T671A probably benign Het
Wasf1 C T 10: 40,934,604 P281S probably damaging Het
Wnt10b C A 15: 98,774,203 R211L probably damaging Het
Xpnpep3 T A 15: 81,448,376 C371* probably null Het
Zfp41 C T 15: 75,618,768 probably benign Het
Zfp553 T A 7: 127,235,511 N79K probably benign Het
Zmynd8 G T 2: 165,792,816 D1096E probably benign Het
Other mutations in Serping1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01376:Serping1 APN 2 84770185 missense probably damaging 1.00
IGL01791:Serping1 APN 2 84773377 missense possibly damaging 0.68
IGL01903:Serping1 APN 2 84769772 critical splice donor site probably null
IGL03182:Serping1 APN 2 84765818 missense probably damaging 1.00
R0094:Serping1 UTSW 2 84773276 missense probably benign 0.00
R0548:Serping1 UTSW 2 84770081 splice site probably benign
R0782:Serping1 UTSW 2 84767446 missense probably damaging 1.00
R1585:Serping1 UTSW 2 84771504 missense probably benign 0.33
R1900:Serping1 UTSW 2 84771449 missense probably damaging 0.99
R1965:Serping1 UTSW 2 84765728 missense probably damaging 1.00
R1966:Serping1 UTSW 2 84765728 missense probably damaging 1.00
R2252:Serping1 UTSW 2 84769851 missense probably damaging 0.99
R2426:Serping1 UTSW 2 84770219 missense probably damaging 0.99
R5665:Serping1 UTSW 2 84771545 missense probably damaging 0.99
R6192:Serping1 UTSW 2 84770268 missense possibly damaging 0.93
R6866:Serping1 UTSW 2 84770233 missense probably benign 0.42
Predicted Primers PCR Primer
(F):5'- CCACTCAAGTAGACAGCATTGAG -3'
(R):5'- CCAGCATTTTGTCATCGTTGG -3'

Sequencing Primer
(F):5'- CTCAAGTAGACAGCATTGAGAAGGAC -3'
(R):5'- GTGAGTTCTAGGCTAGTCAAAGCTAC -3'
Posted On2016-05-10