Incidental Mutation 'R5014:Zcchc11'
ID385419
Institutional Source Beutler Lab
Gene Symbol Zcchc11
Ensembl Gene ENSMUSG00000034610
Gene Namezinc finger, CCHC domain containing 11
Synonyms6030404K05Rik, 9230115F04Rik
MMRRC Submission 042605-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5014 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location108459426-108559421 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 108526846 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120172 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043368] [ENSMUST00000097925] [ENSMUST00000155068]
Predicted Effect probably benign
Transcript: ENSMUST00000043368
SMART Domains Protein: ENSMUSP00000044836
Gene: ENSMUSG00000034610

DomainStartEndE-ValueType
low complexity region 260 275 N/A INTRINSIC
SCOP:d1f5aa2 363 569 2e-23 SMART
Pfam:PAP_assoc 648 701 1.2e-13 PFAM
low complexity region 743 758 N/A INTRINSIC
low complexity region 815 828 N/A INTRINSIC
ZnF_C2HC 931 947 7.79e-3 SMART
Pfam:NTP_transf_2 995 1085 4.2e-10 PFAM
Pfam:PAP_assoc 1201 1254 4.7e-19 PFAM
ZnF_C2HC 1311 1327 3.83e-3 SMART
ZnF_C2HC 1359 1375 3.44e-4 SMART
low complexity region 1398 1412 N/A INTRINSIC
low complexity region 1418 1473 N/A INTRINSIC
low complexity region 1628 1639 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097925
SMART Domains Protein: ENSMUSP00000095538
Gene: ENSMUSG00000034610

DomainStartEndE-ValueType
low complexity region 260 275 N/A INTRINSIC
SCOP:d1f5aa2 363 569 2e-23 SMART
Pfam:PAP_assoc 648 701 8e-14 PFAM
low complexity region 743 758 N/A INTRINSIC
low complexity region 815 828 N/A INTRINSIC
ZnF_C2HC 931 947 7.79e-3 SMART
Pfam:NTP_transf_2 994 1082 6.3e-11 PFAM
Pfam:PAP_assoc 1201 1254 5.2e-19 PFAM
ZnF_C2HC 1311 1327 3.83e-3 SMART
ZnF_C2HC 1364 1380 3.44e-4 SMART
low complexity region 1403 1417 N/A INTRINSIC
low complexity region 1423 1478 N/A INTRINSIC
low complexity region 1632 1643 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138809
Predicted Effect probably benign
Transcript: ENSMUST00000155068
SMART Domains Protein: ENSMUSP00000120172
Gene: ENSMUSG00000034610

DomainStartEndE-ValueType
low complexity region 221 236 N/A INTRINSIC
SCOP:d1f5aa2 324 530 2e-23 SMART
Pfam:PAP_assoc 609 662 8.8e-15 PFAM
low complexity region 704 719 N/A INTRINSIC
low complexity region 776 789 N/A INTRINSIC
ZnF_C2HC 892 908 7.79e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157089
Meta Mutation Damage Score 0.0672 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.4%
  • 20x: 91.7%
Validation Efficiency 97% (83/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ZCCHC11 is an RNA uridyltransferase (EC 2.7.7.52) that uses UTP to add uridines to the 3-prime end of substrate RNA molecules (Jones et al., 2009 [PubMed 19701194]).[supplied by OMIM, Jan 2011]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit partial postnatal lethality associated with postnatal growth retardation and reduced circulating insulin-like growth factor I levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,543,933 T1353A probably benign Het
Abca8b A T 11: 109,950,131 I1072N probably damaging Het
Atp1a2 T C 1: 172,284,871 T517A probably benign Het
Blk T G 14: 63,379,787 N257T probably benign Het
Brd4 A T 17: 32,198,398 probably benign Het
Calr4 C T 4: 109,235,797 Q25* probably null Het
Casc1 T C 6: 145,183,266 E407G probably damaging Het
Cbl T C 9: 44,154,399 probably null Het
Ccdc30 T G 4: 119,393,627 H6P possibly damaging Het
Cd101 A C 3: 101,003,823 Y840D probably damaging Het
Cd68 T A 11: 69,665,339 N178Y probably damaging Het
Cep350 T C 1: 155,928,206 T1044A probably benign Het
Cfap46 A G 7: 139,627,375 V1876A probably benign Het
Clec2g T A 6: 128,948,802 M58K probably benign Het
Clip1 T C 5: 123,617,730 E860G probably damaging Het
Col18a1 C T 10: 77,070,960 probably null Het
Cul7 A G 17: 46,655,942 *650W probably null Het
Dkk4 C T 8: 22,625,299 A55V probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dnase1 C A 16: 4,039,016 Y170* probably null Het
Dnmt1 A C 9: 20,912,254 I1019S probably benign Het
Epha6 T A 16: 59,666,579 H1035L probably benign Het
Fam124b T C 1: 80,200,059 T408A probably benign Het
Fam227b G A 2: 126,116,123 P241S probably damaging Het
Fam71f1 C T 6: 29,326,724 probably benign Het
Galnt7 T C 8: 57,545,380 E305G probably damaging Het
Git1 T A 11: 77,498,995 V28E probably damaging Het
Gm10010 C T 6: 128,200,593 noncoding transcript Het
Gm4956 T C 1: 21,293,597 noncoding transcript Het
Gpr152 T G 19: 4,143,507 V349G probably benign Het
Gtsf1l C T 2: 163,087,192 V124I probably damaging Het
Gucy1b1 C G 3: 82,046,667 G114A probably benign Het
Hk2 T C 6: 82,743,955 Q166R possibly damaging Het
Hook2 A G 8: 84,991,377 I44M probably damaging Het
Ildr1 T A 16: 36,721,559 M222K probably damaging Het
Ints6 A T 14: 62,760,191 F55Y probably benign Het
Kcnh1 A G 1: 192,277,080 N314S probably damaging Het
Lpin3 T C 2: 160,904,828 F748L probably damaging Het
Lrsam1 T C 2: 32,936,395 probably benign Het
Msh2 A T 17: 87,717,576 K627N possibly damaging Het
Myrip A G 9: 120,422,468 Q219R probably damaging Het
Ndufb3 T A 1: 58,591,242 W51R probably damaging Het
Nfasc A T 1: 132,584,447 probably benign Het
Olfr15 T A 16: 3,839,048 I25N probably benign Het
Olfr281 T C 15: 98,456,976 V222A possibly damaging Het
Olfr90 T A 17: 37,085,554 I204F probably benign Het
P3h3 T A 6: 124,855,236 E229V probably damaging Het
Ppfia2 T A 10: 106,865,363 L837* probably null Het
Ppp2r1a G A 17: 20,958,839 probably null Het
Rabgap1 T A 2: 37,487,140 V328E probably damaging Het
Ralgapb G A 2: 158,495,535 R1138Q probably damaging Het
Ranbp2 A T 10: 58,464,120 Q498L probably benign Het
Rbx1 T A 15: 81,470,960 C56S probably damaging Het
Rcan2 T C 17: 44,017,813 F45S probably damaging Het
Rgs20 T C 1: 4,910,547 Y185C probably damaging Het
Rorc T G 3: 94,391,153 L315R probably damaging Het
Skiv2l A G 17: 34,847,425 V194A probably benign Het
Slc13a2 T C 11: 78,400,161 K406E possibly damaging Het
Slc35g3 T A 11: 69,761,040 K62* probably null Het
Sox30 T C 11: 45,991,909 S589P probably benign Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Ssh2 T A 11: 77,455,276 C1362* probably null Het
Tecta C T 9: 42,373,242 C849Y probably damaging Het
Thbs1 T A 2: 118,120,037 probably null Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tyk2 C T 9: 21,115,830 probably null Het
Tyw5 C A 1: 57,406,845 probably benign Het
Vcp T C 4: 42,980,828 T761A probably benign Het
Wdfy4 A T 14: 33,100,940 C1401S probably benign Het
Wiz T C 17: 32,359,366 N391D probably damaging Het
Ylpm1 G A 12: 85,014,749 E475K unknown Het
Zfp108 G T 7: 24,260,738 K251N probably benign Het
Zfp184 A G 13: 21,958,424 D100G probably benign Het
Zfp990 T A 4: 145,538,099 C556S possibly damaging Het
Zkscan16 C T 4: 58,951,892 P189L probably damaging Het
Other mutations in Zcchc11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Zcchc11 APN 4 108550728 missense probably damaging 1.00
IGL00684:Zcchc11 APN 4 108479466 missense possibly damaging 0.80
IGL01598:Zcchc11 APN 4 108550820 unclassified probably benign
IGL01599:Zcchc11 APN 4 108513399 missense possibly damaging 0.85
IGL02088:Zcchc11 APN 4 108512218 splice site probably benign
IGL02451:Zcchc11 APN 4 108529276 nonsense probably null
IGL02667:Zcchc11 APN 4 108558708 splice site probably benign
IGL03080:Zcchc11 APN 4 108505824 missense probably damaging 1.00
IGL03374:Zcchc11 APN 4 108558777 missense probably damaging 1.00
H8786:Zcchc11 UTSW 4 108550815 critical splice donor site probably null
IGL02799:Zcchc11 UTSW 4 108513528 missense probably benign
R0013:Zcchc11 UTSW 4 108530955 splice site probably benign
R0013:Zcchc11 UTSW 4 108530955 splice site probably benign
R0051:Zcchc11 UTSW 4 108527004 missense probably damaging 1.00
R0051:Zcchc11 UTSW 4 108527004 missense probably damaging 1.00
R0410:Zcchc11 UTSW 4 108486555 missense probably benign 0.27
R0698:Zcchc11 UTSW 4 108555533 missense probably benign 0.22
R0745:Zcchc11 UTSW 4 108502955 splice site probably benign
R1080:Zcchc11 UTSW 4 108479499 missense possibly damaging 0.82
R1774:Zcchc11 UTSW 4 108507955 missense probably damaging 1.00
R1809:Zcchc11 UTSW 4 108549355 missense probably damaging 1.00
R1869:Zcchc11 UTSW 4 108529300 missense probably damaging 1.00
R1874:Zcchc11 UTSW 4 108550725 missense probably damaging 1.00
R1958:Zcchc11 UTSW 4 108555706 missense probably damaging 1.00
R1976:Zcchc11 UTSW 4 108479523 missense probably benign 0.01
R2034:Zcchc11 UTSW 4 108512195 missense probably damaging 1.00
R2164:Zcchc11 UTSW 4 108503029 missense possibly damaging 0.73
R2251:Zcchc11 UTSW 4 108520208 missense probably damaging 1.00
R3001:Zcchc11 UTSW 4 108512928 missense probably damaging 1.00
R3002:Zcchc11 UTSW 4 108512928 missense probably damaging 1.00
R3003:Zcchc11 UTSW 4 108512928 missense probably damaging 1.00
R4170:Zcchc11 UTSW 4 108548059 missense probably damaging 1.00
R4667:Zcchc11 UTSW 4 108495159 missense probably damaging 1.00
R4868:Zcchc11 UTSW 4 108549220 splice site probably benign
R4989:Zcchc11 UTSW 4 108526845 unclassified probably benign
R5118:Zcchc11 UTSW 4 108520292 missense possibly damaging 0.92
R5431:Zcchc11 UTSW 4 108491412 missense probably damaging 1.00
R5645:Zcchc11 UTSW 4 108557373 missense probably damaging 1.00
R5661:Zcchc11 UTSW 4 108513187 missense probably benign 0.05
R5877:Zcchc11 UTSW 4 108512923 missense probably damaging 0.99
R6307:Zcchc11 UTSW 4 108555620 missense probably damaging 1.00
R6326:Zcchc11 UTSW 4 108478980 missense probably benign 0.02
R6407:Zcchc11 UTSW 4 108558782 missense probably damaging 1.00
R6493:Zcchc11 UTSW 4 108526805 missense probably damaging 1.00
R6587:Zcchc11 UTSW 4 108479449 missense probably benign
R7215:Zcchc11 UTSW 4 108527008 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTTGGATCGTTCTAGAATAGTCATA -3'
(R):5'- TTAAAGTATAATTATAGATGGCTGGGC -3'

Sequencing Primer
(F):5'- GCAGGCTCCAAGTCTATGCTAATG -3'
(R):5'- GGCTGGGCCTAAAAGAAAAACTTACC -3'
Posted On2016-05-10