Incidental Mutation 'R5014:Msh2'
ID385464
Institutional Source Beutler Lab
Gene Symbol Msh2
Ensembl Gene ENSMUSG00000024151
Gene NamemutS homolog 2
Synonyms
MMRRC Submission 042605-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.830) question?
Stock #R5014 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location87672330-87723713 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 87717576 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 627 (K627N)
Ref Sequence ENSEMBL: ENSMUSP00000024967 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024967]
Predicted Effect possibly damaging
Transcript: ENSMUST00000024967
AA Change: K627N

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000024967
Gene: ENSMUSG00000024151
AA Change: K627N

DomainStartEndE-ValueType
Pfam:MutS_I 17 132 4.6e-22 PFAM
Pfam:MutS_II 150 290 6.7e-23 PFAM
MUTSd 321 645 1e-105 SMART
MUTSac 662 849 3.54e-124 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174703
SMART Domains Protein: ENSMUSP00000133488
Gene: ENSMUSG00000024151

DomainStartEndE-ValueType
Blast:MUTSd 2 63 7e-37 BLAST
PDB:2O8E|A 2 63 4e-32 PDB
SCOP:d1e3ma1 5 53 2e-9 SMART
Meta Mutation Damage Score 0.28 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.4%
  • 20x: 91.7%
Validation Efficiency 97% (83/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus is frequently mutated in hereditary nonpolyposis colon cancer (HNPCC). When cloned, it was discovered to be a human homolog of the E. coli mismatch repair gene mutS, consistent with the characteristic alterations in microsatellite sequences (RER+ phenotype) found in HNPCC. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice homozygous for a number of different targeted mutations develop lymphomas. In addition, depending on the allele, mutants may show intestinal adenocarcinomas and reduced class switch recombination or adenocarcinomas and abnormal mismatch repair or squamous cell carcinomas and skin tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,543,933 T1353A probably benign Het
Abca8b A T 11: 109,950,131 I1072N probably damaging Het
Atp1a2 T C 1: 172,284,871 T517A probably benign Het
Blk T G 14: 63,379,787 N257T probably benign Het
Brd4 A T 17: 32,198,398 probably benign Het
Calr4 C T 4: 109,235,797 Q25* probably null Het
Casc1 T C 6: 145,183,266 E407G probably damaging Het
Cbl T C 9: 44,154,399 probably null Het
Ccdc30 T G 4: 119,393,627 H6P possibly damaging Het
Cd101 A C 3: 101,003,823 Y840D probably damaging Het
Cd68 T A 11: 69,665,339 N178Y probably damaging Het
Cep350 T C 1: 155,928,206 T1044A probably benign Het
Cfap46 A G 7: 139,627,375 V1876A probably benign Het
Clec2g T A 6: 128,948,802 M58K probably benign Het
Clip1 T C 5: 123,617,730 E860G probably damaging Het
Col18a1 C T 10: 77,070,960 probably null Het
Cul7 A G 17: 46,655,942 *650W probably null Het
Dkk4 C T 8: 22,625,299 A55V probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dnase1 C A 16: 4,039,016 Y170* probably null Het
Dnmt1 A C 9: 20,912,254 I1019S probably benign Het
Epha6 T A 16: 59,666,579 H1035L probably benign Het
Fam124b T C 1: 80,200,059 T408A probably benign Het
Fam227b G A 2: 126,116,123 P241S probably damaging Het
Fam71f1 C T 6: 29,326,724 probably benign Het
Galnt7 T C 8: 57,545,380 E305G probably damaging Het
Git1 T A 11: 77,498,995 V28E probably damaging Het
Gm10010 C T 6: 128,200,593 noncoding transcript Het
Gm4956 T C 1: 21,293,597 noncoding transcript Het
Gpr152 T G 19: 4,143,507 V349G probably benign Het
Gtsf1l C T 2: 163,087,192 V124I probably damaging Het
Gucy1b1 C G 3: 82,046,667 G114A probably benign Het
Hk2 T C 6: 82,743,955 Q166R possibly damaging Het
Hook2 A G 8: 84,991,377 I44M probably damaging Het
Ildr1 T A 16: 36,721,559 M222K probably damaging Het
Ints6 A T 14: 62,760,191 F55Y probably benign Het
Kcnh1 A G 1: 192,277,080 N314S probably damaging Het
Lpin3 T C 2: 160,904,828 F748L probably damaging Het
Lrsam1 T C 2: 32,936,395 probably benign Het
Myrip A G 9: 120,422,468 Q219R probably damaging Het
Ndufb3 T A 1: 58,591,242 W51R probably damaging Het
Nfasc A T 1: 132,584,447 probably benign Het
Olfr15 T A 16: 3,839,048 I25N probably benign Het
Olfr281 T C 15: 98,456,976 V222A possibly damaging Het
Olfr90 T A 17: 37,085,554 I204F probably benign Het
P3h3 T A 6: 124,855,236 E229V probably damaging Het
Ppfia2 T A 10: 106,865,363 L837* probably null Het
Ppp2r1a G A 17: 20,958,839 probably null Het
Rabgap1 T A 2: 37,487,140 V328E probably damaging Het
Ralgapb G A 2: 158,495,535 R1138Q probably damaging Het
Ranbp2 A T 10: 58,464,120 Q498L probably benign Het
Rbx1 T A 15: 81,470,960 C56S probably damaging Het
Rcan2 T C 17: 44,017,813 F45S probably damaging Het
Rgs20 T C 1: 4,910,547 Y185C probably damaging Het
Rorc T G 3: 94,391,153 L315R probably damaging Het
Skiv2l A G 17: 34,847,425 V194A probably benign Het
Slc13a2 T C 11: 78,400,161 K406E possibly damaging Het
Slc35g3 T A 11: 69,761,040 K62* probably null Het
Sox30 T C 11: 45,991,909 S589P probably benign Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Ssh2 T A 11: 77,455,276 C1362* probably null Het
Tecta C T 9: 42,373,242 C849Y probably damaging Het
Thbs1 T A 2: 118,120,037 probably null Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tyk2 C T 9: 21,115,830 probably null Het
Tyw5 C A 1: 57,406,845 probably benign Het
Vcp T C 4: 42,980,828 T761A probably benign Het
Wdfy4 A T 14: 33,100,940 C1401S probably benign Het
Wiz T C 17: 32,359,366 N391D probably damaging Het
Ylpm1 G A 12: 85,014,749 E475K unknown Het
Zcchc11 T C 4: 108,526,846 probably benign Het
Zfp108 G T 7: 24,260,738 K251N probably benign Het
Zfp184 A G 13: 21,958,424 D100G probably benign Het
Zfp990 T A 4: 145,538,099 C556S possibly damaging Het
Zkscan16 C T 4: 58,951,892 P189L probably damaging Het
Other mutations in Msh2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01405:Msh2 APN 17 87678235 missense probably damaging 1.00
IGL01602:Msh2 APN 17 87696489 unclassified probably benign
IGL01605:Msh2 APN 17 87696489 unclassified probably benign
IGL01775:Msh2 APN 17 87682646 missense possibly damaging 0.94
IGL02243:Msh2 APN 17 87678368 splice site probably benign
IGL02524:Msh2 APN 17 87678357 missense probably benign 0.01
IGL02730:Msh2 APN 17 87707215 missense probably damaging 1.00
IGL02743:Msh2 APN 17 87707215 missense probably damaging 1.00
IGL03049:Msh2 APN 17 87708509 missense probably damaging 1.00
IGL03282:Msh2 APN 17 87689002 missense probably benign 0.00
IGL03286:Msh2 APN 17 87682667 missense possibly damaging 0.92
R0011:Msh2 UTSW 17 87680093 intron probably benign
R0363:Msh2 UTSW 17 87717476 missense probably benign 0.30
R0520:Msh2 UTSW 17 87717544 missense possibly damaging 0.77
R0633:Msh2 UTSW 17 87672810 splice site probably null
R0862:Msh2 UTSW 17 87680052 missense probably benign
R0864:Msh2 UTSW 17 87680052 missense probably benign
R1146:Msh2 UTSW 17 87680060 missense probably benign 0.00
R1146:Msh2 UTSW 17 87680060 missense probably benign 0.00
R1264:Msh2 UTSW 17 87707179 splice site probably null
R1459:Msh2 UTSW 17 87678343 missense probably benign 0.01
R1572:Msh2 UTSW 17 87718652 missense possibly damaging 0.89
R1592:Msh2 UTSW 17 87680013 intron probably null
R1647:Msh2 UTSW 17 87672636 missense probably benign
R1984:Msh2 UTSW 17 87719296 missense probably damaging 1.00
R2298:Msh2 UTSW 17 87708502 missense probably damaging 0.99
R2871:Msh2 UTSW 17 87685584 missense possibly damaging 0.61
R2871:Msh2 UTSW 17 87685584 missense possibly damaging 0.61
R4383:Msh2 UTSW 17 87689138 missense probably benign 0.00
R4411:Msh2 UTSW 17 87717604 missense probably damaging 0.97
R4589:Msh2 UTSW 17 87680032 missense possibly damaging 0.67
R4598:Msh2 UTSW 17 87708578 missense probably damaging 1.00
R4599:Msh2 UTSW 17 87708578 missense probably damaging 1.00
R4712:Msh2 UTSW 17 87678385 intron probably benign
R4714:Msh2 UTSW 17 87718789 missense probably damaging 1.00
R4834:Msh2 UTSW 17 87723413 missense probably benign
R4842:Msh2 UTSW 17 87723413 missense probably benign
R4859:Msh2 UTSW 17 87718759 missense possibly damaging 0.94
R5007:Msh2 UTSW 17 87723413 missense probably benign
R5008:Msh2 UTSW 17 87723413 missense probably benign
R5010:Msh2 UTSW 17 87723413 missense probably benign
R5048:Msh2 UTSW 17 87672768 missense probably damaging 1.00
R5133:Msh2 UTSW 17 87723413 missense probably benign
R5162:Msh2 UTSW 17 87723413 missense probably benign
R5163:Msh2 UTSW 17 87723413 missense probably benign
R5183:Msh2 UTSW 17 87723413 missense probably benign
R5184:Msh2 UTSW 17 87723413 missense probably benign
R5597:Msh2 UTSW 17 87723361 missense probably benign 0.04
R5655:Msh2 UTSW 17 87719443 missense possibly damaging 0.82
R5973:Msh2 UTSW 17 87708583 missense probably damaging 1.00
R6191:Msh2 UTSW 17 87723472 missense probably benign 0.03
R6632:Msh2 UTSW 17 87712666 missense possibly damaging 0.49
X0058:Msh2 UTSW 17 87679934 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAAACGGCCTTGAGCTAAGTC -3'
(R):5'- ATCTGAATGTATGACCAACCAGAG -3'

Sequencing Primer
(F):5'- CGGCCTTGAGCTAAGTCTATTATAAG -3'
(R):5'- CATTCTTTAATGCCAGAAAGAGAGAC -3'
Posted On2016-05-10