Incidental Mutation 'R5015:Gk5'
ID385509
Institutional Source Beutler Lab
Gene Symbol Gk5
Ensembl Gene ENSMUSG00000041440
Gene Nameglycerol kinase 5 (putative)
SynonymsC330018K18Rik, G630067D24Rik
MMRRC Submission 042606-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5015 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location96119362-96184608 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to G at 96177417 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000112717 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085217] [ENSMUST00000085217] [ENSMUST00000122383] [ENSMUST00000122383] [ENSMUST00000129774]
Predicted Effect probably null
Transcript: ENSMUST00000085217
SMART Domains Protein: ENSMUSP00000082313
Gene: ENSMUSG00000041440

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
Pfam:FGGY_N 25 287 9e-50 PFAM
Pfam:FGGY_C 296 485 7.7e-35 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000085217
SMART Domains Protein: ENSMUSP00000082313
Gene: ENSMUSG00000041440

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
Pfam:FGGY_N 25 287 9e-50 PFAM
Pfam:FGGY_C 296 485 7.7e-35 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000122383
SMART Domains Protein: ENSMUSP00000112717
Gene: ENSMUSG00000041440

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
Pfam:FGGY_N 25 287 1.9e-49 PFAM
Pfam:FGGY_C 296 485 1.8e-35 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000122383
SMART Domains Protein: ENSMUSP00000112717
Gene: ENSMUSG00000041440

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
Pfam:FGGY_N 25 287 1.9e-49 PFAM
Pfam:FGGY_C 296 485 1.8e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129774
SMART Domains Protein: ENSMUSP00000123594
Gene: ENSMUSG00000041440

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
SCOP:d1bu6o1 24 56 1e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189249
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous knockout does not result in an obvious skin phenotype and does not lead to alopecia. [provided by MGI curators]
Allele List at MGI

All alleles(19) : Targeted(2) Gene trapped(17)

Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam25 T A 8: 40,754,634 F312L probably benign Het
Adprm A G 11: 67,042,030 F18L possibly damaging Het
Ampd1 T G 3: 103,099,665 N735K possibly damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atp1a4 T C 1: 172,254,082 M168V probably damaging Het
Bcl6 G A 16: 23,974,850 H116Y probably damaging Het
Bmpr2 T A 1: 59,851,224 N338K probably damaging Het
Bms1 A T 6: 118,404,263 Y697* probably null Het
Ccdc33 A C 9: 58,118,635 F37C probably damaging Het
Ccdc60 T A 5: 116,288,448 Q30L probably benign Het
Cndp1 C A 18: 84,631,911 R219L probably damaging Het
D13Ertd608e T A 13: 119,836,938 probably null Het
Daam2 C A 17: 49,476,522 D627Y probably damaging Het
Dffb T C 4: 153,972,959 D87G possibly damaging Het
Dnah2 T G 11: 69,497,882 T892P possibly damaging Het
Dqx1 A G 6: 83,066,111 T610A probably benign Het
Dspp A T 5: 104,177,060 I430L possibly damaging Het
Dytn T A 1: 63,633,695 K516N probably benign Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fmnl2 T A 2: 53,103,761 N389K possibly damaging Het
Fn1 G A 1: 71,626,177 T927I probably damaging Het
Foxn1 T C 11: 78,371,163 K127E probably damaging Het
Fpr-rs6 A G 17: 20,182,346 F251S probably damaging Het
Frrs1 A G 3: 116,878,439 D62G probably damaging Het
Fut10 T A 8: 31,236,120 V301D probably damaging Het
Glipr1l1 T A 10: 112,078,374 N213K probably benign Het
Gm1110 A G 9: 26,881,866 F538S probably benign Het
Gm11492 C T 11: 87,567,217 S139F possibly damaging Het
Gm5483 T C 16: 36,186,467 probably null Het
Gm7347 T A 5: 26,057,368 T52S probably benign Het
Gsap T C 5: 21,222,408 I178T probably damaging Het
Hcn1 A T 13: 117,603,020 Q106L unknown Het
Hils1 C A 11: 94,968,102 N74K probably damaging Het
Isg20l2 G T 3: 87,931,981 L166F possibly damaging Het
Kcnq3 T A 15: 66,004,763 E510D probably damaging Het
Kif26b G T 1: 178,928,330 R2003L probably damaging Het
Kiss1r T C 10: 79,918,807 V45A probably damaging Het
Krt14 G A 11: 100,207,206 R84* probably null Het
Mbd5 T C 2: 49,258,196 M806T possibly damaging Het
Mdga1 A T 17: 29,839,873 I13N possibly damaging Het
Mfsd4b5 T C 10: 39,974,762 K73E probably benign Het
Mterf2 C T 10: 85,119,732 G343R probably benign Het
Mto1 T A 9: 78,461,621 F522I probably benign Het
Myo18b T C 5: 112,790,057 E1734G probably damaging Het
Myoz1 T C 14: 20,653,719 T53A probably benign Het
Naxd T C 8: 11,513,032 L324P probably damaging Het
Nos1 T A 5: 117,867,269 V18D probably damaging Het
Nova1 T C 12: 46,816,955 T71A unknown Het
Olfr1417 T C 19: 11,828,118 R303G probably benign Het
Olfr389 C G 11: 73,777,181 V49L probably benign Het
Olfr419 A G 1: 174,250,882 L15S possibly damaging Het
Olfr531 T C 7: 140,400,170 D292G probably damaging Het
Olfr690 A G 7: 105,329,604 V196A possibly damaging Het
Otof T A 5: 30,382,894 Y981F probably damaging Het
Peg10 C CTCA 6: 4,756,453 probably benign Het
Pex1 A G 5: 3,620,597 K7E probably damaging Het
Pi4ka A G 16: 17,303,082 S73P possibly damaging Het
Plxnb1 T A 9: 109,100,430 I118N possibly damaging Het
Prcc T C 3: 87,872,253 D158G probably damaging Het
Ptpn7 C A 1: 135,139,139 R245S possibly damaging Het
Ptpre C T 7: 135,669,132 H346Y probably benign Het
Pwp2 A G 10: 78,182,693 C86R probably benign Het
Rfng T G 11: 120,783,050 D178A probably damaging Het
Rhpn1 T C 15: 75,708,241 I51T probably damaging Het
Rnasel G T 1: 153,754,097 E120* probably null Het
Sall2 T G 14: 52,315,655 S26R possibly damaging Het
Scn10a A G 9: 119,622,921 V1312A possibly damaging Het
Sdk2 C A 11: 113,793,761 R1958L probably damaging Het
Slc52a2 T A 15: 76,540,551 C330S probably damaging Het
Smarca2 T A 19: 26,691,388 I987N possibly damaging Het
Srrt A T 5: 137,296,009 Y486N probably damaging Het
Stat5b A T 11: 100,805,005 N50K possibly damaging Het
Strip2 T A 6: 29,931,266 D405E probably benign Het
Tnc A T 4: 64,006,502 D986E probably damaging Het
Tph2 T C 10: 115,079,716 N473S probably benign Het
Tpp1 C T 7: 105,752,025 probably benign Het
Trpm3 T C 19: 22,711,712 Y2H probably damaging Het
Ttc21a A T 9: 119,966,129 E1072V probably damaging Het
Zfat T C 15: 68,178,913 D753G probably damaging Het
Zmym2 T A 14: 56,921,594 S609T probably damaging Het
Other mutations in Gk5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01359:Gk5 APN 9 96137789 missense probably damaging 0.98
IGL01387:Gk5 APN 9 96177554 critical splice donor site probably null
IGL01771:Gk5 APN 9 96177435 missense probably damaging 0.97
IGL02253:Gk5 APN 9 96137771 missense probably damaging 1.00
IGL02380:Gk5 APN 9 96150480 missense possibly damaging 0.92
IGL02566:Gk5 APN 9 96129046 missense possibly damaging 0.56
IGL03137:Gk5 APN 9 96176292 splice site probably benign
IGL03256:Gk5 APN 9 96129053 missense probably damaging 1.00
IGL03326:Gk5 APN 9 96137839 critical splice donor site probably null
barrener UTSW 9 96129096 critical splice donor site probably null
glimpse UTSW 9 96181770 critical splice acceptor site probably null
homer UTSW 9 96140656 nonsense probably null
sean UTSW 9 96176237 nonsense probably null
stripped UTSW 9 96129053 missense probably damaging 1.00
tangyuan UTSW 9 96150797 critical splice donor site probably null
toku UTSW 9 96140629 frame shift probably null
I1329:Gk5 UTSW 9 96140629 frame shift probably null
R0279:Gk5 UTSW 9 96174804 splice site probably benign
R0284:Gk5 UTSW 9 96181770 critical splice acceptor site probably null
R1134:Gk5 UTSW 9 96133407 missense probably benign 0.00
R1184:Gk5 UTSW 9 96150420 splice site probably benign
R1772:Gk5 UTSW 9 96150797 critical splice donor site probably null
R1781:Gk5 UTSW 9 96133455 missense possibly damaging 0.79
R3691:Gk5 UTSW 9 96129096 critical splice donor site probably null
R4213:Gk5 UTSW 9 96129053 missense probably damaging 1.00
R5166:Gk5 UTSW 9 96174768 missense probably damaging 0.99
R5643:Gk5 UTSW 9 96140656 nonsense probably null
R5857:Gk5 UTSW 9 96119455 nonsense probably null
R5924:Gk5 UTSW 9 96150510 critical splice donor site probably null
R6109:Gk5 UTSW 9 96140610 missense probably benign 0.00
R6138:Gk5 UTSW 9 96176237 nonsense probably null
R6725:Gk5 UTSW 9 96155470 missense probably benign 0.01
R6812:Gk5 UTSW 9 96150749 missense probably damaging 0.99
R7065:Gk5 UTSW 9 96179056 missense probably damaging 1.00
R7182:Gk5 UTSW 9 96119526 missense possibly damaging 0.89
R7213:Gk5 UTSW 9 96145712 missense probably damaging 1.00
R7260:Gk5 UTSW 9 96119610 missense probably benign 0.10
U15987:Gk5 UTSW 9 96176237 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGTTCAGCGCCAAGTGATATC -3'
(R):5'- CCATTTTGTGACTGGGGATAAGC -3'

Sequencing Primer
(F):5'- CAGCGCCAAGTGATATCATTTTG -3'
(R):5'- TAAGCTCACAAGGAAGGGCTCC -3'
Posted On2016-05-10