Incidental Mutation 'R5015:Pi4ka'
ID385538
Institutional Source Beutler Lab
Gene Symbol Pi4ka
Ensembl Gene ENSMUSG00000041720
Gene Namephosphatidylinositol 4-kinase alpha
SynonymsPik4ca
MMRRC Submission 042606-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5015 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location17280351-17406314 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 17303082 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 73 (S73P)
Ref Sequence ENSEMBL: ENSMUSP00000121728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036161] [ENSMUST00000142876] [ENSMUST00000154364] [ENSMUST00000232232]
Predicted Effect probably benign
Transcript: ENSMUST00000036161
AA Change: S1263P

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000036162
Gene: ENSMUSG00000041720
AA Change: S1263P

DomainStartEndE-ValueType
low complexity region 198 221 N/A INTRINSIC
low complexity region 243 253 N/A INTRINSIC
SCOP:d1gw5a_ 268 675 2e-3 SMART
low complexity region 895 907 N/A INTRINSIC
PI3Ka 1483 1671 2.11e-54 SMART
Blast:PI3Kc 1688 1762 2e-39 BLAST
PI3Kc 1788 2041 4.04e-106 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000142876
AA Change: S73P

PolyPhen 2 Score 0.560 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000121728
Gene: ENSMUSG00000041720
AA Change: S73P

DomainStartEndE-ValueType
Blast:PI3Kc 1 78 7e-46 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000154364
AA Change: S1263P

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000122550
Gene: ENSMUSG00000041720
AA Change: S1263P

DomainStartEndE-ValueType
low complexity region 198 221 N/A INTRINSIC
low complexity region 243 253 N/A INTRINSIC
SCOP:d1gw5a_ 268 675 2e-3 SMART
low complexity region 895 907 N/A INTRINSIC
PI3Ka 1483 1671 2.11e-54 SMART
Blast:PI3Kc 1688 1762 2e-39 BLAST
PI3Kc 1788 2041 4.04e-106 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000123156
Gene: ENSMUSG00000041720

DomainStartEndE-ValueType
PI3Kc 57 207 1.3e-1 SMART
Predicted Effect unknown
Transcript: ENSMUST00000231683
AA Change: S83P
Predicted Effect unknown
Transcript: ENSMUST00000232232
AA Change: S1263P
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phosphatidylinositol (PI) 4-kinase which catalyzes the first committed step in the biosynthesis of phosphatidylinositol 4,5-bisphosphate. The mammalian PI 4-kinases have been classified into two types, II and III, based on their molecular mass, and modulation by detergent and adenosine. The protein encoded by this gene is a type III enzyme that is not inhibited by adenosine. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for a targeted knock-out or knock-in conditionally activated exhibit premature death associated with degeneration of mucosal cells in the stomach and intestines. Mice homozygous for a knock-out allele exhibit early embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam25 T A 8: 40,754,634 F312L probably benign Het
Adprm A G 11: 67,042,030 F18L possibly damaging Het
Ampd1 T G 3: 103,099,665 N735K possibly damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atp1a4 T C 1: 172,254,082 M168V probably damaging Het
Bcl6 G A 16: 23,974,850 H116Y probably damaging Het
Bmpr2 T A 1: 59,851,224 N338K probably damaging Het
Bms1 A T 6: 118,404,263 Y697* probably null Het
Ccdc33 A C 9: 58,118,635 F37C probably damaging Het
Ccdc60 T A 5: 116,288,448 Q30L probably benign Het
Cndp1 C A 18: 84,631,911 R219L probably damaging Het
D13Ertd608e T A 13: 119,836,938 probably null Het
Daam2 C A 17: 49,476,522 D627Y probably damaging Het
Dffb T C 4: 153,972,959 D87G possibly damaging Het
Dnah2 T G 11: 69,497,882 T892P possibly damaging Het
Dqx1 A G 6: 83,066,111 T610A probably benign Het
Dspp A T 5: 104,177,060 I430L possibly damaging Het
Dytn T A 1: 63,633,695 K516N probably benign Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fmnl2 T A 2: 53,103,761 N389K possibly damaging Het
Fn1 G A 1: 71,626,177 T927I probably damaging Het
Foxn1 T C 11: 78,371,163 K127E probably damaging Het
Fpr-rs6 A G 17: 20,182,346 F251S probably damaging Het
Frrs1 A G 3: 116,878,439 D62G probably damaging Het
Fut10 T A 8: 31,236,120 V301D probably damaging Het
Gk5 A G 9: 96,177,417 probably null Het
Glipr1l1 T A 10: 112,078,374 N213K probably benign Het
Gm1110 A G 9: 26,881,866 F538S probably benign Het
Gm11492 C T 11: 87,567,217 S139F possibly damaging Het
Gm5483 T C 16: 36,186,467 probably null Het
Gm7347 T A 5: 26,057,368 T52S probably benign Het
Gsap T C 5: 21,222,408 I178T probably damaging Het
Hcn1 A T 13: 117,603,020 Q106L unknown Het
Hils1 C A 11: 94,968,102 N74K probably damaging Het
Isg20l2 G T 3: 87,931,981 L166F possibly damaging Het
Kcnq3 T A 15: 66,004,763 E510D probably damaging Het
Kif26b G T 1: 178,928,330 R2003L probably damaging Het
Kiss1r T C 10: 79,918,807 V45A probably damaging Het
Krt14 G A 11: 100,207,206 R84* probably null Het
Mbd5 T C 2: 49,258,196 M806T possibly damaging Het
Mdga1 A T 17: 29,839,873 I13N possibly damaging Het
Mfsd4b5 T C 10: 39,974,762 K73E probably benign Het
Mterf2 C T 10: 85,119,732 G343R probably benign Het
Mto1 T A 9: 78,461,621 F522I probably benign Het
Myo18b T C 5: 112,790,057 E1734G probably damaging Het
Myoz1 T C 14: 20,653,719 T53A probably benign Het
Naxd T C 8: 11,513,032 L324P probably damaging Het
Nos1 T A 5: 117,867,269 V18D probably damaging Het
Nova1 T C 12: 46,816,955 T71A unknown Het
Olfr1417 T C 19: 11,828,118 R303G probably benign Het
Olfr389 C G 11: 73,777,181 V49L probably benign Het
Olfr419 A G 1: 174,250,882 L15S possibly damaging Het
Olfr531 T C 7: 140,400,170 D292G probably damaging Het
Olfr690 A G 7: 105,329,604 V196A possibly damaging Het
Otof T A 5: 30,382,894 Y981F probably damaging Het
Peg10 C CTCA 6: 4,756,453 probably benign Het
Pex1 A G 5: 3,620,597 K7E probably damaging Het
Plxnb1 T A 9: 109,100,430 I118N possibly damaging Het
Prcc T C 3: 87,872,253 D158G probably damaging Het
Ptpn7 C A 1: 135,139,139 R245S possibly damaging Het
Ptpre C T 7: 135,669,132 H346Y probably benign Het
Pwp2 A G 10: 78,182,693 C86R probably benign Het
Rfng T G 11: 120,783,050 D178A probably damaging Het
Rhpn1 T C 15: 75,708,241 I51T probably damaging Het
Rnasel G T 1: 153,754,097 E120* probably null Het
Sall2 T G 14: 52,315,655 S26R possibly damaging Het
Scn10a A G 9: 119,622,921 V1312A possibly damaging Het
Sdk2 C A 11: 113,793,761 R1958L probably damaging Het
Slc52a2 T A 15: 76,540,551 C330S probably damaging Het
Smarca2 T A 19: 26,691,388 I987N possibly damaging Het
Srrt A T 5: 137,296,009 Y486N probably damaging Het
Stat5b A T 11: 100,805,005 N50K possibly damaging Het
Strip2 T A 6: 29,931,266 D405E probably benign Het
Tnc A T 4: 64,006,502 D986E probably damaging Het
Tph2 T C 10: 115,079,716 N473S probably benign Het
Tpp1 C T 7: 105,752,025 probably benign Het
Trpm3 T C 19: 22,711,712 Y2H probably damaging Het
Ttc21a A T 9: 119,966,129 E1072V probably damaging Het
Zfat T C 15: 68,178,913 D753G probably damaging Het
Zmym2 T A 14: 56,921,594 S609T probably damaging Het
Other mutations in Pi4ka
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Pi4ka APN 16 17308144 missense probably benign
IGL00984:Pi4ka APN 16 17358932 nonsense probably null
IGL01066:Pi4ka APN 16 17348773 splice site probably benign
IGL01460:Pi4ka APN 16 17357651 missense probably damaging 1.00
IGL01505:Pi4ka APN 16 17309358 missense probably benign 0.22
IGL01518:Pi4ka APN 16 17280735 missense probably benign 0.03
IGL01533:Pi4ka APN 16 17308201 missense probably benign 0.30
IGL01565:Pi4ka APN 16 17389442 utr 5 prime probably benign
IGL01679:Pi4ka APN 16 17296888 splice site probably benign
IGL01685:Pi4ka APN 16 17325202 missense probably benign 0.09
IGL01734:Pi4ka APN 16 17297260 missense probably benign 0.23
IGL01799:Pi4ka APN 16 17389371 missense probably damaging 1.00
IGL01969:Pi4ka APN 16 17378483 missense probably benign 0.15
IGL02092:Pi4ka APN 16 17318496 missense probably benign 0.00
IGL02113:Pi4ka APN 16 17373415 missense probably benign 0.00
IGL02177:Pi4ka APN 16 17318282 missense probably benign 0.09
IGL02400:Pi4ka APN 16 17293884 missense probably damaging 0.98
IGL02426:Pi4ka APN 16 17378432 splice site probably benign
IGL02474:Pi4ka APN 16 17325429 missense probably damaging 1.00
IGL02587:Pi4ka APN 16 17317353 missense probably damaging 1.00
IGL02667:Pi4ka APN 16 17295461 missense possibly damaging 0.82
IGL02698:Pi4ka APN 16 17291168 missense probably damaging 1.00
IGL02815:Pi4ka APN 16 17358889 splice site probably benign
IGL02828:Pi4ka APN 16 17280711 intron probably benign
IGL02939:Pi4ka APN 16 17354210 missense probably damaging 0.97
IGL03123:Pi4ka APN 16 17282675 missense possibly damaging 0.95
IGL03148:Pi4ka APN 16 17354189 missense probably damaging 0.99
arachnoid UTSW 16 17285281 unclassified probably benign
mia UTSW 16 17376982 missense possibly damaging 0.89
pia UTSW 16 17281044 missense probably damaging 1.00
R6720_Pi4ka_560 UTSW 16 17326052 splice site probably null
IGL03098:Pi4ka UTSW 16 17326027 missense probably damaging 1.00
R0024:Pi4ka UTSW 16 17315535 splice site probably benign
R0054:Pi4ka UTSW 16 17325114 missense probably null 1.00
R0054:Pi4ka UTSW 16 17325114 missense probably null 1.00
R0243:Pi4ka UTSW 16 17297635 missense probably benign 0.44
R0374:Pi4ka UTSW 16 17282932 unclassified probably benign
R0478:Pi4ka UTSW 16 17309311 missense possibly damaging 0.92
R0548:Pi4ka UTSW 16 17307718 missense possibly damaging 0.75
R0626:Pi4ka UTSW 16 17293901 missense probably benign 0.00
R0918:Pi4ka UTSW 16 17285260 missense possibly damaging 0.61
R1082:Pi4ka UTSW 16 17389352 missense probably damaging 1.00
R1384:Pi4ka UTSW 16 17297537 splice site probably benign
R1455:Pi4ka UTSW 16 17363954 missense probably benign 0.02
R1479:Pi4ka UTSW 16 17373400 missense probably benign 0.08
R1490:Pi4ka UTSW 16 17386268 missense probably damaging 1.00
R1565:Pi4ka UTSW 16 17281900 missense probably null
R1594:Pi4ka UTSW 16 17373419 splice site probably benign
R1641:Pi4ka UTSW 16 17377030 missense probably benign 0.00
R1694:Pi4ka UTSW 16 17295376 missense probably damaging 0.99
R1828:Pi4ka UTSW 16 17280750 missense probably benign 0.00
R1864:Pi4ka UTSW 16 17367525 nonsense probably null
R2036:Pi4ka UTSW 16 17303112 missense probably damaging 1.00
R2151:Pi4ka UTSW 16 17367507 missense probably benign 0.44
R2844:Pi4ka UTSW 16 17350793 missense probably damaging 0.97
R2876:Pi4ka UTSW 16 17367550 missense possibly damaging 0.77
R3953:Pi4ka UTSW 16 17285281 unclassified probably benign
R3972:Pi4ka UTSW 16 17293875 missense probably damaging 1.00
R4357:Pi4ka UTSW 16 17367439 missense probably benign 0.00
R4385:Pi4ka UTSW 16 17386265 missense probably benign 0.13
R4427:Pi4ka UTSW 16 17281044 missense probably damaging 1.00
R4436:Pi4ka UTSW 16 17282382 missense probably damaging 1.00
R4677:Pi4ka UTSW 16 17282373 missense probably damaging 1.00
R4683:Pi4ka UTSW 16 17297037 missense possibly damaging 0.73
R4736:Pi4ka UTSW 16 17377175 missense probably benign 0.12
R4804:Pi4ka UTSW 16 17308161 missense possibly damaging 0.75
R4886:Pi4ka UTSW 16 17358361 missense probably damaging 0.98
R4893:Pi4ka UTSW 16 17377036 missense probably benign 0.21
R4896:Pi4ka UTSW 16 17377169 missense probably damaging 1.00
R5004:Pi4ka UTSW 16 17377169 missense probably damaging 1.00
R5062:Pi4ka UTSW 16 17309397 missense probably benign 0.02
R5104:Pi4ka UTSW 16 17281050 missense probably damaging 1.00
R5160:Pi4ka UTSW 16 17323053 missense probably benign 0.01
R5173:Pi4ka UTSW 16 17350906 missense possibly damaging 0.95
R5204:Pi4ka UTSW 16 17359045 missense possibly damaging 0.68
R5307:Pi4ka UTSW 16 17323030 missense probably benign 0.00
R5327:Pi4ka UTSW 16 17325413 missense probably damaging 1.00
R5506:Pi4ka UTSW 16 17293953 missense probably damaging 0.96
R5580:Pi4ka UTSW 16 17281087 missense probably damaging 1.00
R5768:Pi4ka UTSW 16 17354872 missense probably benign 0.29
R5857:Pi4ka UTSW 16 17358984 missense probably benign 0.00
R5951:Pi4ka UTSW 16 17303142 missense probably damaging 1.00
R5953:Pi4ka UTSW 16 17281951 missense probably damaging 1.00
R6041:Pi4ka UTSW 16 17360572 missense probably benign
R6223:Pi4ka UTSW 16 17357571 nonsense probably null
R6416:Pi4ka UTSW 16 17358322 missense probably benign 0.22
R6535:Pi4ka UTSW 16 17301036 missense probably damaging 1.00
R6580:Pi4ka UTSW 16 17350830 missense probably damaging 1.00
R6720:Pi4ka UTSW 16 17326052 splice site probably null
R6723:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6725:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6752:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6753:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6755:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6767:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6768:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6782:Pi4ka UTSW 16 17325988 missense probably damaging 1.00
R6782:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6788:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6849:Pi4ka UTSW 16 17303421 missense possibly damaging 0.54
R6958:Pi4ka UTSW 16 17325227 missense probably damaging 1.00
R7014:Pi4ka UTSW 16 17297067 unclassified probably benign
R7055:Pi4ka UTSW 16 17317015 utr 3 prime probably benign
R7317:Pi4ka UTSW 16 17405632 critical splice donor site probably null
U24488:Pi4ka UTSW 16 17325176 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TAGGATTTACTCTACACTGCAGAGC -3'
(R):5'- CTGAGCTTTGTAGGGACAGC -3'

Sequencing Primer
(F):5'- TGCAGAGCAGCATCGCAG -3'
(R):5'- ACAGCCTTGGGGACACTTG -3'
Posted On2016-05-10