Incidental Mutation 'R5016:Anapc1'
ID385559
Institutional Source Beutler Lab
Gene Symbol Anapc1
Ensembl Gene ENSMUSG00000014355
Gene Nameanaphase promoting complex subunit 1
Synonyms2610021O03Rik, tsg24, Apc1, Mcpr
MMRRC Submission 042607-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5016 (G1)
Quality Score150
Status Validated
Chromosome2
Chromosomal Location128610104-128687391 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to T at 128607175 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000014499 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014499]
Predicted Effect probably benign
Transcript: ENSMUST00000014499
SMART Domains Protein: ENSMUSP00000014499
Gene: ENSMUSG00000014355

DomainStartEndE-ValueType
Pfam:ANAPC1 150 214 1.7e-13 PFAM
low complexity region 323 345 N/A INTRINSIC
low complexity region 1404 1415 N/A INTRINSIC
Pfam:PC_rep 1467 1501 8.3e-8 PFAM
low complexity region 1516 1528 N/A INTRINSIC
low complexity region 1924 1936 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118288
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209672
Meta Mutation Damage Score 0.0572 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.2%
  • 10x: 95.1%
  • 20x: 91.0%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the anaphase-promoting complex. This complex is an E3 ubiquitin ligase that regulates progression through the metaphase to anaphase portion of the cell cycle by ubiquitinating proteins which targets them for degradation. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp C T 16: 56,671,268 P768S probably damaging Het
Adprhl1 A G 8: 13,224,889 L623P possibly damaging Het
Ankzf1 C A 1: 75,195,978 probably benign Het
Ash1l A G 3: 88,982,323 D503G probably damaging Het
Atp7b T C 8: 22,015,869 probably null Het
Bach1 T A 16: 87,719,318 V249D possibly damaging Het
Ccdc158 A G 5: 92,657,892 S335P probably benign Het
Chd9 T A 8: 91,006,626 C1374* probably null Het
Col16a1 C T 4: 130,079,195 T643M probably benign Het
Cygb A G 11: 116,650,014 F49L probably benign Het
Dnah17 G C 11: 118,080,766 T2147S probably damaging Het
Drd3 C A 16: 43,762,246 A34E possibly damaging Het
Ephb6 G A 6: 41,618,107 R685Q probably benign Het
Ezh1 G A 11: 101,199,237 probably benign Het
Gpr19 T A 6: 134,869,917 K231* probably null Het
Gpr61 A G 3: 108,150,667 V226A possibly damaging Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Hnrnpul2 A G 19: 8,822,825 K185R possibly damaging Het
Igsf9 A C 1: 172,490,712 T140P probably damaging Het
Ksr2 A G 5: 117,500,792 D87G probably benign Het
Llgl2 A G 11: 115,853,424 E843G probably damaging Het
Ltbp4 GT G 7: 27,327,685 probably null Het
Luc7l2 A G 6: 38,585,101 I20V possibly damaging Het
Mcm6 G A 1: 128,343,427 T485M probably damaging Het
Miox A G 15: 89,335,564 D85G probably null Het
Nudt18 T C 14: 70,579,463 F169S probably benign Het
Nxpe4 A G 9: 48,392,885 N91D probably benign Het
Olfr1089 T G 2: 86,732,746 I289L probably benign Het
Olfr155 T C 4: 43,854,596 S96P probably benign Het
Olfr811 A G 10: 129,801,793 V244A probably benign Het
Pdss2 G T 10: 43,222,005 A82S probably damaging Het
Ptprs T C 17: 56,419,070 D998G probably damaging Het
Rasd2 C A 8: 75,221,975 N176K probably damaging Het
Serpinb3a A G 1: 107,046,330 F284L probably damaging Het
Skint6 T A 4: 113,171,533 probably null Het
Slc12a6 C T 2: 112,356,627 probably benign Het
Slc22a19 G A 19: 7,674,372 T490M probably benign Het
Sp2 A T 11: 96,955,832 C562S probably damaging Het
Specc1 A G 11: 62,118,957 E433G possibly damaging Het
Sspo C T 6: 48,452,280 Q451* probably null Het
St6galnac1 A T 11: 116,765,880 S478T probably damaging Het
Steap4 C T 5: 7,976,699 R221* probably null Het
Ugt1a5 C G 1: 88,166,241 R64G probably benign Het
Vmn1r202 A T 13: 22,502,205 F14Y probably damaging Het
Vmn2r79 T C 7: 87,037,340 V643A probably benign Het
Vmn2r91 C A 17: 18,110,060 Y535* probably null Het
Wdr3 A T 3: 100,141,620 probably benign Het
Wdr95 T C 5: 149,544,801 M41T probably benign Het
Other mutations in Anapc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Anapc1 APN 2 128645130 splice site probably benign
IGL00704:Anapc1 APN 2 128663984 missense possibly damaging 0.48
IGL01023:Anapc1 APN 2 128629729 missense probably damaging 1.00
IGL01432:Anapc1 APN 2 128633408 missense probably damaging 1.00
IGL01549:Anapc1 APN 2 128653170 missense probably benign
IGL02089:Anapc1 APN 2 128663933 missense probably damaging 1.00
IGL02275:Anapc1 APN 2 128659852 missense probably benign
IGL02570:Anapc1 APN 2 128645200 missense probably damaging 1.00
IGL02597:Anapc1 APN 2 128623931 missense probably benign 0.02
IGL02726:Anapc1 APN 2 128659785 missense probably benign 0.05
IGL03265:Anapc1 APN 2 128627197 missense probably damaging 1.00
IGL03304:Anapc1 APN 2 128627113 splice site probably benign
IGL03327:Anapc1 APN 2 128623934 missense probably benign 0.00
R0023:Anapc1 UTSW 2 128678218 missense probably damaging 0.99
R0027:Anapc1 UTSW 2 128641511 missense possibly damaging 0.96
R0027:Anapc1 UTSW 2 128641511 missense possibly damaging 0.96
R0084:Anapc1 UTSW 2 128623966 splice site probably benign
R0103:Anapc1 UTSW 2 128680452 splice site probably benign
R0103:Anapc1 UTSW 2 128680452 splice site probably benign
R0109:Anapc1 UTSW 2 128634693 missense probably damaging 1.00
R0109:Anapc1 UTSW 2 128634693 missense probably damaging 1.00
R0241:Anapc1 UTSW 2 128628629 missense possibly damaging 0.89
R0241:Anapc1 UTSW 2 128628629 missense possibly damaging 0.89
R0255:Anapc1 UTSW 2 128634711 missense probably damaging 0.99
R0377:Anapc1 UTSW 2 128641340 critical splice donor site probably null
R0467:Anapc1 UTSW 2 128669043 missense probably damaging 0.99
R0514:Anapc1 UTSW 2 128632655 missense probably damaging 0.99
R0591:Anapc1 UTSW 2 128619332 missense probably benign 0.17
R0919:Anapc1 UTSW 2 128617731 missense probably benign
R1175:Anapc1 UTSW 2 128680188 missense probably damaging 1.00
R1473:Anapc1 UTSW 2 128617697 missense possibly damaging 0.88
R1547:Anapc1 UTSW 2 128617556 missense probably benign 0.44
R1556:Anapc1 UTSW 2 128624899 missense probably benign 0.00
R1567:Anapc1 UTSW 2 128617716 missense probably damaging 1.00
R1635:Anapc1 UTSW 2 128628532 missense probably damaging 1.00
R1645:Anapc1 UTSW 2 128658246 critical splice donor site probably null
R1677:Anapc1 UTSW 2 128676208 missense probably benign 0.09
R1854:Anapc1 UTSW 2 128675890 missense probably damaging 1.00
R1856:Anapc1 UTSW 2 128659788 missense probably damaging 0.96
R1959:Anapc1 UTSW 2 128633415 missense probably benign 0.36
R1984:Anapc1 UTSW 2 128669688 missense possibly damaging 0.85
R2034:Anapc1 UTSW 2 128648458 missense possibly damaging 0.92
R2283:Anapc1 UTSW 2 128642548 missense probably benign 0.23
R2928:Anapc1 UTSW 2 128680137 missense probably damaging 1.00
R3547:Anapc1 UTSW 2 128642682 missense possibly damaging 0.58
R3904:Anapc1 UTSW 2 128642519 missense probably damaging 1.00
R4156:Anapc1 UTSW 2 128627229 intron probably benign
R4359:Anapc1 UTSW 2 128623556 missense possibly damaging 0.64
R4392:Anapc1 UTSW 2 128676249 critical splice acceptor site probably null
R4574:Anapc1 UTSW 2 128627195 missense probably damaging 1.00
R4682:Anapc1 UTSW 2 128664005 missense probably benign 0.05
R4770:Anapc1 UTSW 2 128686060 splice site probably benign
R4824:Anapc1 UTSW 2 128628690 missense possibly damaging 0.69
R4960:Anapc1 UTSW 2 128684594 missense probably benign 0.23
R5063:Anapc1 UTSW 2 128629549 missense possibly damaging 0.48
R5128:Anapc1 UTSW 2 128659917 missense probably benign
R5271:Anapc1 UTSW 2 128685985 nonsense probably null
R5363:Anapc1 UTSW 2 128650194 critical splice donor site probably null
R5469:Anapc1 UTSW 2 128675701 nonsense probably null
R5473:Anapc1 UTSW 2 128607195 unclassified probably benign
R5559:Anapc1 UTSW 2 128680434 nonsense probably null
R5631:Anapc1 UTSW 2 128657217 missense possibly damaging 0.85
R5747:Anapc1 UTSW 2 128624916 missense probably benign 0.19
R5840:Anapc1 UTSW 2 128607037 unclassified probably benign
R6226:Anapc1 UTSW 2 128650372 missense probably damaging 1.00
R6526:Anapc1 UTSW 2 128672135 nonsense probably null
R6561:Anapc1 UTSW 2 128663999 missense probably damaging 0.98
R6743:Anapc1 UTSW 2 128684534 nonsense probably null
R6799:Anapc1 UTSW 2 128659737 missense probably null 0.38
R6887:Anapc1 UTSW 2 128659768 missense possibly damaging 0.91
R6978:Anapc1 UTSW 2 128669900 missense probably benign 0.06
R7041:Anapc1 UTSW 2 128628656 missense possibly damaging 0.88
R7047:Anapc1 UTSW 2 128615430 missense probably damaging 0.96
R7074:Anapc1 UTSW 2 128678274 missense probably damaging 1.00
R7109:Anapc1 UTSW 2 128674602 missense probably benign 0.33
R7123:Anapc1 UTSW 2 128613010 missense probably damaging 1.00
R7309:Anapc1 UTSW 2 128674684 missense probably damaging 0.96
X0066:Anapc1 UTSW 2 128674701 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- CAGTTGGTAGAGTCAAGTTGGCAG -3'
(R):5'- TTACAGCCTGGAATCCCATTAC -3'

Sequencing Primer
(F):5'- GTCAAGTTGGCAGTTTATAAAGGAC -3'
(R):5'- TCTTGTTACCTAAGGAATGGCC -3'
Posted On2016-05-10