Incidental Mutation 'R5016:Luc7l2'
ID385572
Institutional Source Beutler Lab
Gene Symbol Luc7l2
Ensembl Gene ENSMUSG00000029823
Gene NameLUC7-like 2 (S. cerevisiae)
Synonyms4930471C18Rik, CGI-59, CGI-74
MMRRC Submission 042607-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.351) question?
Stock #R5016 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location38551334-38609470 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 38585101 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 20 (I20V)
Ref Sequence ENSEMBL: ENSMUSP00000125394 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057692] [ENSMUST00000159936] [ENSMUST00000160511] [ENSMUST00000161227] [ENSMUST00000161538] [ENSMUST00000162386] [ENSMUST00000163047]
Predicted Effect probably benign
Transcript: ENSMUST00000057692
AA Change: I73V

PolyPhen 2 Score 0.354 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000055254
Gene: ENSMUSG00000029823
AA Change: I73V

DomainStartEndE-ValueType
Pfam:LUC7 5 257 6.5e-84 PFAM
low complexity region 269 341 N/A INTRINSIC
low complexity region 347 370 N/A INTRINSIC
low complexity region 377 388 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159936
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160430
SMART Domains Protein: ENSMUSP00000124686
Gene: ENSMUSG00000029823

DomainStartEndE-ValueType
Pfam:LUC7 1 211 9.9e-70 PFAM
low complexity region 217 281 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160511
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160582
Predicted Effect possibly damaging
Transcript: ENSMUST00000161227
AA Change: I20V

PolyPhen 2 Score 0.526 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000125111
Gene: ENSMUSG00000029823
AA Change: I20V

DomainStartEndE-ValueType
Pfam:LUC7 1 288 6.9e-65 PFAM
low complexity region 294 317 N/A INTRINSIC
low complexity region 324 335 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161538
AA Change: I73V

PolyPhen 2 Score 0.354 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000124010
Gene: ENSMUSG00000029823
AA Change: I73V

DomainStartEndE-ValueType
Pfam:LUC7 4 309 3.3e-93 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162386
Predicted Effect possibly damaging
Transcript: ENSMUST00000163047
AA Change: I20V

PolyPhen 2 Score 0.537 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000125394
Gene: ENSMUSG00000029823
AA Change: I20V

DomainStartEndE-ValueType
Pfam:LUC7 1 257 3.2e-66 PFAM
Meta Mutation Damage Score 0.064 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.2%
  • 10x: 95.1%
  • 20x: 91.0%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains a C2H2-type zinc finger, coiled-coil region and arginine, serine-rich (RS) domain. A similar protein in mouse interacts with sodium channel modifier 1, and the encoded protein may be involved in the recognition of non-consensus splice donor sites in association with the U1 snRNP spliceosomal subunit. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2011]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp C T 16: 56,671,268 P768S probably damaging Het
Adprhl1 A G 8: 13,224,889 L623P possibly damaging Het
Anapc1 A T 2: 128,607,175 probably benign Het
Ankzf1 C A 1: 75,195,978 probably benign Het
Ash1l A G 3: 88,982,323 D503G probably damaging Het
Atp7b T C 8: 22,015,869 probably null Het
Bach1 T A 16: 87,719,318 V249D possibly damaging Het
Ccdc158 A G 5: 92,657,892 S335P probably benign Het
Chd9 T A 8: 91,006,626 C1374* probably null Het
Col16a1 C T 4: 130,079,195 T643M probably benign Het
Cygb A G 11: 116,650,014 F49L probably benign Het
Dnah17 G C 11: 118,080,766 T2147S probably damaging Het
Drd3 C A 16: 43,762,246 A34E possibly damaging Het
Ephb6 G A 6: 41,618,107 R685Q probably benign Het
Ezh1 G A 11: 101,199,237 probably benign Het
Gpr19 T A 6: 134,869,917 K231* probably null Het
Gpr61 A G 3: 108,150,667 V226A possibly damaging Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Hnrnpul2 A G 19: 8,822,825 K185R possibly damaging Het
Igsf9 A C 1: 172,490,712 T140P probably damaging Het
Ksr2 A G 5: 117,500,792 D87G probably benign Het
Llgl2 A G 11: 115,853,424 E843G probably damaging Het
Ltbp4 GT G 7: 27,327,685 probably null Het
Mcm6 G A 1: 128,343,427 T485M probably damaging Het
Miox A G 15: 89,335,564 D85G probably null Het
Nudt18 T C 14: 70,579,463 F169S probably benign Het
Nxpe4 A G 9: 48,392,885 N91D probably benign Het
Olfr1089 T G 2: 86,732,746 I289L probably benign Het
Olfr155 T C 4: 43,854,596 S96P probably benign Het
Olfr811 A G 10: 129,801,793 V244A probably benign Het
Pdss2 G T 10: 43,222,005 A82S probably damaging Het
Ptprs T C 17: 56,419,070 D998G probably damaging Het
Rasd2 C A 8: 75,221,975 N176K probably damaging Het
Serpinb3a A G 1: 107,046,330 F284L probably damaging Het
Skint6 T A 4: 113,171,533 probably null Het
Slc12a6 C T 2: 112,356,627 probably benign Het
Slc22a19 G A 19: 7,674,372 T490M probably benign Het
Sp2 A T 11: 96,955,832 C562S probably damaging Het
Specc1 A G 11: 62,118,957 E433G possibly damaging Het
Sspo C T 6: 48,452,280 Q451* probably null Het
St6galnac1 A T 11: 116,765,880 S478T probably damaging Het
Steap4 C T 5: 7,976,699 R221* probably null Het
Ugt1a5 C G 1: 88,166,241 R64G probably benign Het
Vmn1r202 A T 13: 22,502,205 F14Y probably damaging Het
Vmn2r79 T C 7: 87,037,340 V643A probably benign Het
Vmn2r91 C A 17: 18,110,060 Y535* probably null Het
Wdr3 A T 3: 100,141,620 probably benign Het
Wdr95 T C 5: 149,544,801 M41T probably benign Het
Other mutations in Luc7l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Luc7l2 APN 6 38608170 unclassified probably benign
IGL00684:Luc7l2 APN 6 38608176 unclassified probably benign
IGL00785:Luc7l2 APN 6 38598786 missense possibly damaging 0.73
R0004:Luc7l2 UTSW 6 38589234 missense probably damaging 1.00
R0304:Luc7l2 UTSW 6 38592776 missense probably damaging 0.98
R1820:Luc7l2 UTSW 6 38598819 splice site probably null
R2223:Luc7l2 UTSW 6 38565724 intron probably benign
R3815:Luc7l2 UTSW 6 38570591 missense possibly damaging 0.83
Z1088:Luc7l2 UTSW 6 38603369 utr 3 prime probably benign
Predicted Primers PCR Primer
(F):5'- GTGTACTCACTGCATGACTTAGTAT -3'
(R):5'- CTGGAGATAAGTGCTTGTTACTATCAG -3'

Sequencing Primer
(F):5'- CTGAAGAGAACTGTGATAGTG -3'
(R):5'- ACTTTTATACAGCCGGGCAG -3'
Posted On2016-05-10