Incidental Mutation 'R5016:Ephb6'
ID385573
Institutional Source Beutler Lab
Gene Symbol Ephb6
Ensembl Gene ENSMUSG00000029869
Gene NameEph receptor B6
SynonymsCekl, Mep
MMRRC Submission 042607-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.405) question?
Stock #R5016 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location41605482-41620509 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 41618107 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 685 (R685Q)
Ref Sequence ENSEMBL: ENSMUSP00000110380 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031902] [ENSMUST00000114732] [ENSMUST00000201471]
Predicted Effect probably benign
Transcript: ENSMUST00000031902
SMART Domains Protein: ENSMUSP00000031902
Gene: ENSMUSG00000029868

DomainStartEndE-ValueType
ANK 44 74 2.39e2 SMART
ANK 78 107 6.17e-1 SMART
ANK 116 145 3.06e-5 SMART
ANK 162 191 1.85e-4 SMART
Blast:ANK 195 223 3e-10 BLAST
ANK 238 267 2.47e2 SMART
Pfam:Ion_trans 327 589 9.8e-18 PFAM
low complexity region 680 695 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114732
AA Change: R685Q

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000110380
Gene: ENSMUSG00000029869
AA Change: R685Q

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
EPH_lbd 34 227 2.18e-100 SMART
low complexity region 242 255 N/A INTRINSIC
Pfam:GCC2_GCC3 299 341 1.9e-9 PFAM
FN3 365 462 3.59e-3 SMART
FN3 481 562 3.73e-10 SMART
Pfam:EphA2_TM 589 660 3.4e-16 PFAM
Pfam:Pkinase 663 908 1.4e-29 PFAM
Pfam:Pkinase_Tyr 663 908 1.1e-67 PFAM
SAM 938 1005 1e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167082
Predicted Effect probably benign
Transcript: ENSMUST00000167497
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170624
Predicted Effect probably benign
Transcript: ENSMUST00000201471
SMART Domains Protein: ENSMUSP00000143854
Gene: ENSMUSG00000029868

DomainStartEndE-ValueType
ANK 44 74 2.39e2 SMART
ANK 78 107 6.17e-1 SMART
ANK 116 145 3.06e-5 SMART
ANK 162 191 1.85e-4 SMART
Blast:ANK 195 223 3e-10 BLAST
ANK 238 267 2.47e2 SMART
Pfam:Ion_trans 327 589 9.8e-18 PFAM
low complexity region 680 695 N/A INTRINSIC
Meta Mutation Damage Score 0.09 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.2%
  • 10x: 95.1%
  • 20x: 91.0%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of transmembrane proteins that function as receptors for ephrin-B family proteins. Unlike other members of this family, the encoded protein does not contain a functional kinase domain. Activity of this protein can influence cell adhesion and migration. Expression of this gene is downregulated during tumor progression, suggesting that the protein may suppress tumor invasion and metastasis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: T cell responses such as lymphokine secretion, proliferation, and the development of delayed-type skin hypersensitivity and experimental autoimmune encephalitis were compromised in homozygous null mutants. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp C T 16: 56,671,268 P768S probably damaging Het
Adprhl1 A G 8: 13,224,889 L623P possibly damaging Het
Anapc1 A T 2: 128,607,175 probably benign Het
Ankzf1 C A 1: 75,195,978 probably benign Het
Ash1l A G 3: 88,982,323 D503G probably damaging Het
Atp7b T C 8: 22,015,869 probably null Het
Bach1 T A 16: 87,719,318 V249D possibly damaging Het
Ccdc158 A G 5: 92,657,892 S335P probably benign Het
Chd9 T A 8: 91,006,626 C1374* probably null Het
Col16a1 C T 4: 130,079,195 T643M probably benign Het
Cygb A G 11: 116,650,014 F49L probably benign Het
Dnah17 G C 11: 118,080,766 T2147S probably damaging Het
Drd3 C A 16: 43,762,246 A34E possibly damaging Het
Ezh1 G A 11: 101,199,237 probably benign Het
Gpr19 T A 6: 134,869,917 K231* probably null Het
Gpr61 A G 3: 108,150,667 V226A possibly damaging Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Hnrnpul2 A G 19: 8,822,825 K185R possibly damaging Het
Igsf9 A C 1: 172,490,712 T140P probably damaging Het
Ksr2 A G 5: 117,500,792 D87G probably benign Het
Llgl2 A G 11: 115,853,424 E843G probably damaging Het
Ltbp4 GT G 7: 27,327,685 probably null Het
Luc7l2 A G 6: 38,585,101 I20V possibly damaging Het
Mcm6 G A 1: 128,343,427 T485M probably damaging Het
Miox A G 15: 89,335,564 D85G probably null Het
Nudt18 T C 14: 70,579,463 F169S probably benign Het
Nxpe4 A G 9: 48,392,885 N91D probably benign Het
Olfr1089 T G 2: 86,732,746 I289L probably benign Het
Olfr155 T C 4: 43,854,596 S96P probably benign Het
Olfr811 A G 10: 129,801,793 V244A probably benign Het
Pdss2 G T 10: 43,222,005 A82S probably damaging Het
Ptprs T C 17: 56,419,070 D998G probably damaging Het
Rasd2 C A 8: 75,221,975 N176K probably damaging Het
Serpinb3a A G 1: 107,046,330 F284L probably damaging Het
Skint6 T A 4: 113,171,533 probably null Het
Slc12a6 C T 2: 112,356,627 probably benign Het
Slc22a19 G A 19: 7,674,372 T490M probably benign Het
Sp2 A T 11: 96,955,832 C562S probably damaging Het
Specc1 A G 11: 62,118,957 E433G possibly damaging Het
Sspo C T 6: 48,452,280 Q451* probably null Het
St6galnac1 A T 11: 116,765,880 S478T probably damaging Het
Steap4 C T 5: 7,976,699 R221* probably null Het
Ugt1a5 C G 1: 88,166,241 R64G probably benign Het
Vmn1r202 A T 13: 22,502,205 F14Y probably damaging Het
Vmn2r79 T C 7: 87,037,340 V643A probably benign Het
Vmn2r91 C A 17: 18,110,060 Y535* probably null Het
Wdr3 A T 3: 100,141,620 probably benign Het
Wdr95 T C 5: 149,544,801 M41T probably benign Het
Other mutations in Ephb6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01375:Ephb6 APN 6 41615911 unclassified probably benign
IGL01691:Ephb6 APN 6 41614515 missense probably benign 0.26
IGL02052:Ephb6 APN 6 41613322 missense probably benign
IGL02079:Ephb6 APN 6 41616014 missense possibly damaging 0.57
IGL03089:Ephb6 APN 6 41614174 missense probably damaging 1.00
P4748:Ephb6 UTSW 6 41617285 missense probably damaging 0.96
R0022:Ephb6 UTSW 6 41614569 missense probably damaging 0.98
R0022:Ephb6 UTSW 6 41614569 missense probably damaging 0.98
R0106:Ephb6 UTSW 6 41619594 unclassified probably benign
R0106:Ephb6 UTSW 6 41619594 unclassified probably benign
R0973:Ephb6 UTSW 6 41614104 missense probably damaging 0.98
R0973:Ephb6 UTSW 6 41614104 missense probably damaging 0.98
R0974:Ephb6 UTSW 6 41614104 missense probably damaging 0.98
R1465:Ephb6 UTSW 6 41616106 missense probably damaging 1.00
R1465:Ephb6 UTSW 6 41616106 missense probably damaging 1.00
R1610:Ephb6 UTSW 6 41614373 nonsense probably null
R1658:Ephb6 UTSW 6 41614245 missense probably damaging 1.00
R1687:Ephb6 UTSW 6 41617366 missense probably benign 0.08
R1733:Ephb6 UTSW 6 41619720 missense probably benign 0.10
R2191:Ephb6 UTSW 6 41616085 missense possibly damaging 0.82
R2439:Ephb6 UTSW 6 41618735 missense probably benign 0.31
R2915:Ephb6 UTSW 6 41614238 missense probably damaging 1.00
R3020:Ephb6 UTSW 6 41614521 missense probably damaging 1.00
R3499:Ephb6 UTSW 6 41616159 nonsense probably null
R4606:Ephb6 UTSW 6 41616574 missense probably benign 0.15
R4663:Ephb6 UTSW 6 41617865 missense probably damaging 1.00
R4668:Ephb6 UTSW 6 41614602 missense possibly damaging 0.91
R4762:Ephb6 UTSW 6 41618160 missense probably damaging 0.99
R4767:Ephb6 UTSW 6 41614185 missense possibly damaging 0.81
R4780:Ephb6 UTSW 6 41616139 missense probably damaging 1.00
R4846:Ephb6 UTSW 6 41616809 missense probably benign
R4851:Ephb6 UTSW 6 41618145 missense probably benign 0.00
R5122:Ephb6 UTSW 6 41613404 missense probably benign 0.00
R5313:Ephb6 UTSW 6 41616793 missense possibly damaging 0.68
R5615:Ephb6 UTSW 6 41619291 missense probably benign
R5623:Ephb6 UTSW 6 41616481 missense probably benign 0.20
R5686:Ephb6 UTSW 6 41619704 missense possibly damaging 0.57
R5840:Ephb6 UTSW 6 41615573 missense possibly damaging 0.94
R6147:Ephb6 UTSW 6 41616781 missense probably damaging 1.00
R6645:Ephb6 UTSW 6 41617272 missense probably benign 0.01
R6730:Ephb6 UTSW 6 41617374 nonsense probably null
X0027:Ephb6 UTSW 6 41620080 makesense probably null
Predicted Primers PCR Primer
(F):5'- TACATACGATGACCCCTGCC -3'
(R):5'- TCTGTCAGCACCATGACAGG -3'

Sequencing Primer
(F):5'- CTCGAGAGGTTGACCCTACATATATC -3'
(R):5'- ATGACAGGCCGACTCTTAGTGAC -3'
Posted On2016-05-10